Primer & Oligo Design Answers After Choosing a Calculator

Interactive checks included25+ short answers

Fast answers after choosing a calculator. Use this page when you need a fast support answer after choosing a calculator. It does not replace the calculation pages; move to the right tool for action: Tm Calculator for NEB/IDT/Twist-style Tm calculations, Primer Analyzer for OligoAnalyzer-style checks, and Secondary Structure Predictor for hairpins and dimers.

Search-to-action shortcuts

If you landed here from search and still need a calculation, start with the calculator page. Use this FAQ when you need the short explanation after a result or when you are choosing the right next tool.

Accuracy Follow-up — When Results Need Context

Where should I check NEB, IDT, or Twist-style Tm results?

Use the Tm Calculator as the primary action page for vendor-style Tm checks. It lets you match salt, Mg²⁺, DMSO, and oligo concentration assumptions before you compare values from another calculator.

Sequence (20-mer)OligoPoolNEBIDTDifference
ATCGATCGATCGATCGATCG56.4°C56.4°C56.6°C±0.2°C
GCGCATATATATGCGCATAT49.5°C49.7°C49.9°C±0.2°C
GCCGCCGCCGCCGCCGCCGCC78.1°C78.3°C78.5°C±0.2°C

Example conditions: 50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo concentration. Run the Tm Calculator or review the calculation methodology.

▶ Try it yourself

Open Tm Calculator for the actual result

What should I check before trusting a calculated Tm?

Check the method, salt assumptions, oligo concentration, and whether Mg²⁺ or DMSO corrections are enabled. Most Tm disagreements come from condition mismatch, not from the sequence itself.

What differs between tools is:

  • Salt correction formula — use a method suitable for your PCR buffer
  • Batch review — use batch mode when primer pairs or pools must be checked together
  • PrivacyBrowser by default; History/Library/API may save

For the calculation itself, open the Tm Calculator. Use this page for follow-up interpretation.

Open Tm Calculator for the actual result

When should I use Primer Analyzer instead of a single Tm answer?

Use the Primer Analyzer when you need a combined primer review that includes Tm, GC%, molecular weight, hairpins, self-dimers, hetero-dimers, and mismatch checks in one report.

FeatureOligoPool.comIDT OligoAnalyzerNEB Tm Calculator
Tm AlgorithmSantaLucia 1998 NNSantaLucia 1998 NNSantaLucia 1998 NN
Salt CorrectionOwczarzy 2008Owczarzy 2004Owczarzy 2008
Batch Processing1,000 free / 50,000 memberOne at a timeOne at a time
Secondary StructuresΔG with structuresDetailed diagramsNot available
Account RequiredNoFree accountNo
Data PrivacyBrowser by default; History/Library/API may saveServer-sideServer-side
Pool/Library QCFull suiteLimitedNot available

For a detailed comparison, see OligoPool vs IDT — Full Feature Comparison. For immediate analysis, open the Primer Analyzer.

Open Tm Calculator for the actual result

Is my sequence data secure? Do you store it?

Browser by default; History/Library/API may save. When Dashboard History save is enabled, History stores the full input snapshot so you can restore a run. Usage analytics stores aggregate events, not sequence text or result rows. Use local downloads instead when you want a fully local handoff.

Open Tm Calculator for the actual result

Tm Follow-up — Methods, Accuracy & Salt Corrections

Which Tm calculation method should I use for PCR primers?

The nearest-neighbor (NN) thermodynamic method is commonly preferred for primers and probes because it accounts for stacking interactions between adjacent base pairs, not just base composition.

MethodAccuracyOligo LengthBest For
Nearest-Neighbor (SantaLucia 1998)±1-2°C15-70 ntPCR primers, probes — recommended
Wallace Rule (2°C×AT + 4°C×GC)±5-10°C≤14 ntQuick mental estimates only
%GC Method±3-5°CAnyRough estimates, assumes 1M NaCl

The Tm Calculator uses SantaLucia 1998 with Owczarzy 2008 salt correction for settings where those assumptions fit the experiment.

▶ Try it yourself

Calculate Tm with matched buffer settings

Why do different calculators give different Tm values?

Differences of ±2°C between calculators are normal and come from: 1) Different parameter sets — SantaLucia 1998 vs older Breslauer 1986, 2) Different salt corrections — Owczarzy 2008 vs older SantaLucia 1998 formula, 3) Assumed oligo concentration — 0.25 µM vs 0.5 µM, 4) Initiation parameter handling — how terminal base pairs are counted.

Bottom line: If your result differs from NEB by more than 2°C, check that you're using the same salt concentrations. Na⁺ and Mg²⁺ settings cause 90% of discrepancies.

Calculate Tm with matched buffer settings

What salt concentrations should I use for my PCR buffer?

Use your actual buffer concentrations for accurate Tm prediction. Common defaults:

ApplicationNa⁺ (mM)Mg²⁺ (mM)Notes
Standard Taq PCR501.5-2.5Most common buffer
Phusion / Q5 HF502.0Use manufacturer's Ta calculator
qPCR / Real-time503.0-5.0Higher Mg²⁺ for probe binding
Hybridization / FISH50-1000-5Check SSC buffer recipe

Critical: Changing Na⁺ from 50→100 mM shifts Tm by +3-5°C. Changing Mg²⁺ from 1.5→3 mM shifts Tm by +1.5-2.5°C. Always match your actual conditions.

Calculate Tm with matched buffer settings

What is a good Tm for PCR primers?

For standard PCR: 55-65°C, with 58-62°C being optimal. Primer pairs should have Tm within 5°C of each other (ideally within 2°C). Set annealing temperature (Ta) 5°C below the lower Tm. For high-fidelity enzymes (Phusion, Q5): higher Tm (65-72°C) may be recommended — check the manufacturer's Ta calculator. For qPCR probes: Tm 5-10°C above the primer Tm for effective 5' nuclease assay.

Calculate Tm with matched buffer settings

Can I calculate Tm for modified oligonucleotides (LNA, PTO, 2'-OMe)?

Standard nearest-neighbor parameters are for unmodified DNA. Terminal modifications (5'-phosphate, biotin, fluorescent labels at 5' end) have negligible effect on Tm (<0.5°C). However, backbone modifications significantly affect stability: LNA (+2-6°C per substitution), phosphorothioate (-0.5°C per substitution), 2'-O-methyl RNA (+1-2°C per substitution). The calculator supports unmodified DNA/RNA. For modified oligos, use the calculated Tm as a baseline and adjust empirically.

Calculate Tm with matched buffer settings

Secondary Structures — Hairpins, Dimers & ΔG Thresholds

What ΔG thresholds indicate a problematic secondary structure?

Use these ΔG values as practical review points, then weigh the structure location and assay conditions:

Structure TypeAcceptable ΔGCritical (Redesign)Impact
Hairpins> -2 kcal/mol< -3 kcal/molSelf-folding blocks target binding
Self-dimers> -5 kcal/mol< -6 kcal/molReduces available primer
3' End dimers> -5 kcal/mol< -7 kcal/molPrevents polymerase extension
Cross-dimers> -6 kcal/mol< -8 kcal/molPrimer-dimer artifacts on gel

Check your sequences with the Secondary Structure Predictor. For a detailed tutorial, see How to Detect and Fix Secondary Structures.

▶ Check your sequence

Run Secondary Structure Predictor

How do I fix a sequence with problematic secondary structures?

Strategies ordered by effectiveness:

  1. Shift the primer binding site by 2-5 bases upstream or downstream — often eliminates the hairpin without changing target specificity
  2. Introduce silent mutations (for gene assembly oligos) — change G→A or C→T at non-critical positions to break the complementary stem
  3. Shorten the primer — remove bases involved in the self-complementary region (maintain Tm >55°C)
  4. Add DMSO (3-10%) to the reaction — destabilizes secondary structures by 0.5-0.7°C per 1% DMSO
  5. Raise annealing temperature — above the structure's Tm, favoring target binding over self-folding

For 3' end dimers specifically: avoid 3' ends with >3 consecutive G/C bases. This is the single most impactful rule for preventing primer-dimer artifacts.

Run Secondary Structure Predictor

What is the difference between a hairpin, self-dimer, and cross-dimer?

A hairpin is when a single strand folds back on itself, forming a stem-loop structure (intramolecular). A self-dimer is when two copies of the same sequence bind to each other (intermolecular). A cross-dimer (hetero-dimer) is when two different sequences (e.g., forward and reverse primers) bind to each other. All three compete with the intended target binding, reducing PCR efficiency. 3' end involvement is most critical — dimers at the 3' end are extended by polymerase, creating primer-dimer artifacts visible as ~40-100 bp bands on gels.

Run Secondary Structure Predictor

Are secondary structures always bad? When can I ignore them?

Not always. Structures with ΔG > -2 kcal/mol are generally harmless. Structures in the 5' overhang region (outside the target-binding portion) are usually acceptable. Temperature context matters: a structure stable at 25°C but unstable at your annealing temperature (55-65°C) will not interfere with PCR. For hybridization probes (FISH, ISH), structures are less critical because longer hybridization times overcome kinetic barriers. Focus on 3' end structures — these are always problematic because they directly block polymerase extension.

Run Secondary Structure Predictor

Primer Design — Checklist, GC Content & Best Practices

What is the best checklist for PCR primer design?

Follow this systematic 5-step checklist:

StepCheckTargetTool
1. DesignLength, position18-25 ntPrimer3 / manual
2. Tm CheckMelting temp55-65°C, ΔTm <5°CTm Calculator
3. GC CheckGC content40-60%GC Analyzer
4. StructureHairpins, dimersΔG > -3 kcal/molStructure Predictor
5. SpecificityOff-targetsNo off-target hitsNCBI BLAST

For detailed guidance with examples, see the primer validation checklist.

Open Primer Analyzer for full primer review

What GC content is optimal for my application?

For PCR primers: 40-60% is ideal, with 45-55% being optimal. For qPCR probes: 50-60% provides good stability. For oligo pools/libraries: keep GC uniform across all sequences to avoid representation bias. Avoid extremes: <30% GC produces unstable duplexes with low Tm; >70% GC promotes secondary structures (G-quadruplexes, hairpins) that reduce synthesis yield and binding efficiency. Use the GC Content Analyzer to check your sequences before ordering.

Open Primer Analyzer for full primer review

How do I choose the right oligonucleotide calculator for my needs?

It depends on your application:

Open Primer Analyzer for full primer review

How do I resuspend lyophilized oligos to a target concentration?

Formula: Volume (µL) = nmoles / (target µM) × 1000. Example: 100 nmol oligo to 100 µM stock = 100/100 × 1000 = 1000 µL (1 mL) in TE buffer (10 mM Tris, 0.1 mM EDTA, pH 8.0). For accurate quantification after resuspension, measure A₂₆₀ absorbance — 1 OD₂₆₀ ≈ 33 µg/mL for single-stranded DNA. Use the Molecular Weight Calculator to get the extinction coefficient (ε₂₆₀) for precise concentration determination via Beer-Lambert law: Concentration = A₂₆₀ / (ε₂₆₀ × path length).

Open Primer Analyzer for full primer review

Oligo Pools — Synthesis, Vendors & Quality

What is an oligo pool and when should I use one?

An oligo pool is a complex mixture of thousands to millions of unique oligonucleotides synthesized in a single reaction using array-based synthesis. Use pools when you need >100 unique sequences for the same experiment (CRISPR libraries, NGS panels, mutagenesis, gene assembly). For <100 sequences or when you need each oligo individually (PCR primers, probes), order individual oligos instead.

Start with the Oligo Pool Guide for the full design, QC, vendor, and ordering path. Use Oligo Pool vs Individual Oligos when the first decision is whether pooled synthesis is appropriate.

Open the Oligo Pool Guide

How do oligo pool vendors compare?
Decision FieldWhat to ConfirmWhere to Go Next
Pool size and sub-poolsMinimum/maximum sequence count, sub-pool handling, and delivery formatOpen page
Full oligo lengthLength after adapters, handles, barcodes, UMIs, and constant regionsOpen page
QC scopeIncluded, optional, or excluded QC; report format; raw per-sequence data availabilityOpen page
Turnaround and quote termsWhether timing means production start, shipment, delivery, or QC report availabilityOpen page

Use the Oligo Pool Vendor Comparison for vendor selection and the vendor specification notes for documented product-page details.

Open the Oligo Pool Guide

How do I validate my oligo pool library before synthesis?

Run these checks before ordering to avoid costly redesign:

  1. Upload all sequences to Batch Sequence QC — checks GC%, Tm, homopolymers, length
  2. Target >90% pass rate (for CRISPR screens, aim >95%)
  3. Check Tm uniformity — pool Tm CV should be <3°C for functional assays
  4. Run secondary structure check on flagged sequences
  5. Use Vendor Format Adapter to generate the correct order file format

Open the Oligo Pool Guide

Practical Usage — Batch Processing, Formats & Export

Can I process multiple sequences at once? How many?
Yes! Multiple tools support batch processing: Batch Sequence QC (1,000 free / 50,000 member sequences), Tm Calculator batch mode (up to 1,000), GC Content Analyzer (bulk upload), and Format Converter (1,000 free / 50,000 member sequences). Upload FASTA, CSV, or TSV files, or paste one sequence per line.

Run Batch Sequence QC before export

What sequence formats are supported?

We support FASTA (single-line and multi-line), CSV, TSV, and plain text (one sequence per line). The Format Converter tool auto-detects input format and converts between them. For vendor ordering: use the Vendor Format Adapter to generate IDT, Twist, GenScript, or Dynegene-specific order files.

Run Batch Sequence QC before export

Can I export calculation results?

Yes. Most tools support CSV/Excel export. Batch QC generates comprehensive reports with per-sequence details and pool-level statistics. The Vendor Format Adapter exports ready-to-upload order files for each supported vendor.

Run Batch Sequence QC before export

How do I cite these tools in publications?
Cite the underlying scientific methods rather than the website: SantaLucia, J. (1998) Proc. Natl. Acad. Sci. 95, 1460-1465 for Tm calculations; Owczarzy, R. et al. (2008) Biochemistry 47, 5336-5353 for salt corrections. You may additionally acknowledge "OligoPool.com" as the implementation tool. See the Scientific References page for full citations.

Run Batch Sequence QC before export

Still Have Questions?

Send the sequence context, tool output, and assay type so the question can be routed clearly.