Last Updated: May 1, 2026 | Content Status: 2026 Latest Edition

Structure AnalysisIntermediate8 min

How to Check Hairpins, Self-Dimers & Primer Dimers

Use this tutorial when you need the steps, not just the calculator. The fastest path is: run the Secondary Structure Predictor, set the analysis temperature to your annealing or assay temperature, check hairpins, self-dimers, and hetero-dimers, then compare ΔG values against the redesign thresholds. Hairpins below about -3 kcal/mol and dimers below about -5 kcal/mol deserve attention, especially if a 3' end is involved.

Key Takeaways

  • YesSecondary structures (hairpins, dimers) can interfere with oligonucleotide function and reduce efficiency
  • YesHairpins form when sequences fold back on themselves, creating stable stem-loop structures
  • YesSelf-dimers occur when a sequence binds to itself, while hetero-dimers form between different sequences
  • YesΔG (free energy) values indicate structure stability: more negative = more stable = more problematic
  • YesAcceptable ΔG thresholds: hairpins > -3 kcal/mol, dimers > -5 kcal/mol
  • YesHigh-risk structures require sequence redesign or exclusion from pools

Quick Secondary Structure Check Workflow

Follow this 5-step workflow to check your primers or oligonucleotides for problematic secondary structures:

1

Open the Secondary Structure Predictor

Start on the dedicated Secondary Structure Predictor page, then return here if you need interpretation help.

2

Input Your Sequence(s)

Paste primer or oligo sequence (for primer pairs, enter both forward and reverse)

3

Set Analysis Temperature

Use 37°C (default) or match your experimental conditions (55-65°C for PCR primers)

4

Select Structure Types

Check: Yes Hairpins, Yes Self-dimers, Yes Hetero-dimers (for primer pairs)

5

Interpret ΔG Values

Check results against thresholds:

  • PASS: Hairpins ΔG > -3 kcal/mol, Dimers ΔG > -5 kcal/mol
  • CAUTION: Hairpins -3 to -6, Dimers -5 to -8 kcal/mol (test or redesign)
  • FAIL: Hairpins ΔG < -6, Dimers ΔG < -8 kcal/mol (redesign required)

Critical check: Structures involving 3' ends are most problematic for PCR primers. Even moderate ΔG values (< -5 kcal/mol) at 3' ends should trigger redesign.

Understanding Secondary Structures

Secondary structures are stable conformations that oligonucleotides adopt through base pairing. Unlike the intended binding to target sequences, these structures form within or between oligonucleotides themselves, interfering with function. Three main types are problematic:

Thermodynamic Background: How ΔG Calculation Works

Secondary structure prediction uses the nearest-neighbor thermodynamic model, which calculates free energy (ΔG) based on the stability of adjacent base pair interactions. This method considers:

  • Base pair stacking energies: Each dinucleotide step (e.g., AT/TA, GC/GC) contributes specific ΔG values
  • Loop penalties: Small loops (3-6 nucleotides) destabilize structures due to entropic costs
  • Terminal penalties: End effects from unpaired bases or terminal AT pairs
  • Salt concentration: Monovalent/divalent cations stabilize base pairing (typically 50 mM Na⁺, 1.5 mM Mg²⁺)
  • Temperature dependence: ΔG = ΔH - TΔS (enthalpy and entropy contributions change with temperature)

Why this matters: More negative ΔG indicates thermodynamically favorable (stable) structures. At experimental temperatures, structures with ΔG < -5 to -8 kcal/mol are highly likely to form, making them problematic for primer function. Our calculator uses validated nearest-neighbor thermodynamic parameters (SantaLucia 1998, SantaLucia & Hicks 2004) for accurate prediction.

Critical Technical Factors:

  • 3' End Rule: The last 5 nucleotides at the 3' end are most critical. Even weak complementarity (≥3 consecutive bp) at 3' ends can enable primer extension and dimer amplification, causing PCR artifacts.
  • GC Content Impact: GC-rich sequences (≥60% GC) form more stable secondary structures due to stronger triple hydrogen bonds. Consider both overall structure ΔG and local GC content when designing primers.
  • Loop Size Effect: Hairpins with 3-5 nucleotide loops are most stable (minimal entropic penalty). Larger loops (>6 nt) or smaller loops (1-2 nt) are less stable but can still form problematic structures.
  • Standard Conditions: Calculations assume 50 mM Na⁺, 1.5 mM Mg²⁺, pH 7.0. Higher salt concentrations stabilize structures (more negative ΔG), so adjust thresholds if using different buffer conditions.

1. Hairpins (Stem-Loops)

Hairpins form when a sequence folds back on itself, creating a stem (double-stranded region) and a loop (single-stranded region). They occur when complementary regions within the same sequence can base-pair.

Hairpin Structure Visualization

5' End3' EndStem (Base Pairs)Loop Region

Hairpin structure showing stem-loop formation

Example hairpin-forming sequence:

5'-ATCGATCGGCGATCGATCGATCGAT-3'
|||||||||
CGCTAGCTA

Impact: Hairpins at the 3' end prevent primer extension in PCR. Internal hairpins can reduce binding efficiency and cause non-specific products. The stability of hairpins increases with longer stems and smaller loops, making ΔG analysis critical for predicting their impact.

2. Self-Dimers

Self-dimers occur when a single oligonucleotide binds to itself through complementary regions. This reduces the effective concentration available for binding to the target sequence.

Self-Dimer Structure Visualization

5' —————————————————— 3'3' —————————————————— 5'Complementary Base PairsSame SequenceSelf-Binding

Self-dimer showing intramolecular base pairing

Impact: Reduces PCR efficiency, causes non-specific amplification, and can lead to primer-dimer artifacts in gel electrophoresis. Self-dimers are particularly problematic when they involve the 3' end, as this prevents proper primer extension.

3. Hetero-Dimers (Primer-Dimers)

Hetero-dimers form when two different sequences (e.g., forward and reverse primers) bind to each other through complementary regions. This is particularly problematic in PCR.

Hetero-Dimer (Primer-Dimer) Visualization

Forward Primer: 5' ———————————————— 3'Reverse Primer: 5' ———————————————— 3'!Complementary Region3' EndsCritical!

Hetero-dimer between forward and reverse primers

Impact: Causes primer-dimer artifacts, reduces target amplification, and can lead to false-positive results in qPCR. Complementarity at 3' ends is especially problematic as it allows extension and amplification of the dimer. This is the most common cause of PCR failure in multiplex reactions.

Step-by-Step Tutorial: Using the Secondary Structure Predictor

Step 1: Access the Tool

Navigate to the Secondary Structure Predictor. The tool supports analysis of single sequences or primer pairs.

Step 2: Input Your Sequence

Paste your oligonucleotide sequence into the input field. For primer pairs, enter both forward and reverse sequences.

Example primer pair:
Forward: ATCGATCGATCGATCGATCG
Reverse: GCTAGCTAGCTAGCTAGCTA

Step 3: Set Analysis Temperature

Set the temperature to match your experimental conditions. Temperature significantly affects structure stability:

ApplicationRecommended TemperatureRationale
PCR Primers55-65°CMatch annealing temperature for accurate prediction
qPCR Probes60-65°CHybridization temperature during probe binding
CRISPR Guides37°CPhysiological temperature for cellular activity
Hybridization AssaysVariableUse actual experimental hybridization temperature
General Analysis37°C (default)Conservative default; structures more stable at lower temps

Key principle: Structures are more stable at lower temperatures. Using a lower temperature (like 37°C) provides a conservative assessment—if structures are acceptable at 37°C, they'll be even less problematic at higher experimental temperatures. However, for accurate prediction, always match your actual experimental conditions when possible.

Our Secondary Structure Predictor allows you to set custom temperatures to match your specific experimental conditions.

Step 4: Select Structure Types

Choose which structures to analyze:

  • Hairpins: Always check for single sequences
  • Self-dimers: Check for each primer individually
  • Hetero-dimers: Essential for primer pairs

For comprehensive analysis, check all relevant structure types.

Step 5: Interpret Results

Review the ΔG values for each detected structure. The following tables show industry standard thresholds and our conservative recommendations:

ΔG Threshold Comparison: Industry Standard Tools

Different primer design tools use varying ΔG thresholds. Our conservative thresholds provide higher design reliability:

Structure TypePrimer3
(default)
IDT OligoAnalyzer
("strong")
This Tool
(conservative)
Hairpin< -9.0 kcal/mol< -2.0 kcal/mol< -3.0 kcal/mol
Self-Dimer< -6.0 kcal/mol< -5.0 kcal/mol< -5.0 kcal/mol
Hetero-Dimer< -6.0 kcal/mol< -5.0 kcal/mol< -5.0 kcal/mol
3' End Complementarity-3.0 kcal/molAny ≥3 bpAny ≥3 bp

Note: Values shown are"problematic" thresholds (structures worse than these values should be avoided). Primer3 uses more relaxed defaults suitable for routine PCR, while IDT and this tool use stricter criteria for higher success rates. All calculations assume standard PCR conditions: 50 mM Na⁺, 1.5 mM Mg²⁺, pH 7.0.

Structure TypeAcceptable
(ΔG, kcal/mol)
Moderate Risk
(ΔG, kcal/mol)
High Risk
(ΔG, kcal/mol)
Action Required
Hairpins> -3
(pref. > -2)
-3 to -6< -6Accept if > -3; redesign if < -6
Self-Dimers> -5
(pref. > -3)
-5 to -8< -8Accept if > -5; redesign if < -8
Hetero-Dimers> -5
(pref. > -3)
-5 to -8< -8Critical for primer pairs; redesign if < -8

Note: Structures involving 3' ends are particularly problematic for PCR primers, as they prevent extension by DNA polymerase. Always prioritize checking 3' end complementarity in primer design.

Acceptable Structures:

  • Hairpins: ΔG > -3 kcal/mol (preferably > -2 kcal/mol)
  • Self-dimers: ΔG > -5 kcal/mol (preferably > -3 kcal/mol)
  • Hetero-dimers: ΔG > -5 kcal/mol (preferably > -3 kcal/mol)

Moderate Risk:

  • Hairpins: ΔG -3 to -6 kcal/mol
  • Dimers: ΔG -5 to -8 kcal/mol
  • May cause issues depending on application and experimental conditions

High Risk (Redesign Required):

  • Hairpins: ΔG < -6 kcal/mol
  • Dimers: ΔG < -8 kcal/mol
  • Structures involving 3' ends
  • Will likely cause experimental failures

Step 6: Take Action

Based on the results:

  • Acceptable structures: Proceed with sequence
  • Moderate risk: Consider redesign or test experimentally
  • High risk: Redesign sequence to break complementarity

After redesign, re-analyze to confirm structures are resolved.

Troubleshooting: Fixing Problematic Structures

When structures are detected, several strategies can help resolve them:

Strategy 1: Sequence Redesign

Modify the sequence to break complementarity while maintaining function:

  • Change bases in stem regions to non-complementary
  • Introduce mismatches that break base pairing
  • Modify sequence length to avoid problematic regions
  • Maintain critical functional regions (e.g., 3' end for primers)

Strategy 2: Experimental Modifications

Adjust experimental conditions to reduce structure formation:

  • Increase annealing/hybridization temperature
  • Add denaturants (DMSO, formamide) to reduce structure stability
  • Use touchdown PCR to minimize primer-dimer formation
  • Optimize salt concentrations

Strategy 3: Modified Bases

For critical applications, consider modified bases:

  • Locked nucleic acids (LNAs) reduce structure formation
  • 2'-O-methyl bases modify base pairing properties
  • Phosphorothioate linkages can reduce secondary structures

Note: Modified bases may affect other properties and increase cost.

Worked Examples: Real Primer Validation with ΔG Analysis

These real-world examples demonstrate how to check sequences, interpret ΔG values, and fix problematic structures:

Note on ΔG values: The ΔG values shown in these examples are representative calculations based on nearest-neighbor thermodynamic parameters at standard conditions (50 mM Na⁺, 1.5 mM Mg²⁺, pH 7.0). Actual values may vary slightly depending on salt concentration, temperature, and calculation method. Use these examples as guidelines for interpreting your own results.

Example 1: Well-Designed PCR Primer (PASS)

Sequence: 5'-GTCAGCTGATCGTACGTATC-3'
Length: 20 bp
Analysis Temperature: 60°C

Structure Check Results:

  • YesHairpins: ΔG = -1.2 kcal/mol (PASS: > -3 threshold)
  • YesSelf-dimers: ΔG = -2.8 kcal/mol (PASS: > -5 threshold)
  • Yes3' end complementarity: None detected

Verdict: This primer passes all structure checks. The weak hairpin and self-dimer structures (ΔG values close to 0) indicate minimal secondary structure formation. Safe to use for PCR.

Example 2: Primer with Problematic Hairpin (FAIL → REDESIGN)

Original Sequence (Failed):

Sequence: 5'-ATCGCGATCGCGATCGATCG-3'
Length: 20 bp
Analysis Temperature: 60°C

Structure Check Results:

  • NoHairpins: ΔG = -8.4 kcal/mol (FAIL: < -6 threshold)
  • Hairpin location: Involves positions 5-15 (stem) with 3 bp loop
  • Problem: Strong stem (8 consecutive base pairs) creates stable hairpin structure

Redesigned Sequence (Fixed):

Sequence: 5'-ATCGCAATGACGATCGATCG-3'
Changes: Position 7 (G→A), Position 9 (T→T), Position 10 (C→A) to break stem complementarity

Re-check Results:

  • YesHairpins: ΔG = -2.1 kcal/mol (PASS: > -3 threshold)
  • YesImprovement: ΔG improved by +6.3 kcal/mol (less stable = better)

Redesign strategy: Introduced 3 mismatches in the stem region to break base pairing while maintaining GC content (~50%). The redesigned primer maintains similar Tm but eliminates the problematic hairpin structure.

Example 3: Primer Pair with 3' Hetero-Dimer (FAIL → REDESIGN)

Original Primer Pair (Failed):

Forward: 5'-AGCTGATCGTACGTACCGTA-3'
Reverse: 5'-TCGACTGCATGCATTACGG-3'
Note: 3' ends (underlined) are complementary

Hetero-Dimer Check Results:

  • NoHetero-dimer ΔG: -9.2 kcal/mol (FAIL: < -8 threshold)
  • !Critical issue: 5 bp complementarity at 3' ends allows primer extension
  • Impact: Will form primer-dimer artifacts, reducing target amplification

Redesigned Reverse Primer (Fixed):

Forward: 5'-AGCTGATCGTACGTACCGTA-3' (unchanged)
Reverse: 5'-TCGACTGCATGCATGACAT-3'
Changes: Modified last 5 bases to eliminate 3' complementarity

Re-check Results:

  • YesHetero-dimer ΔG: -3.8 kcal/mol (PASS: > -5 threshold)
  • Yes3' complementarity: Eliminated (max 2 consecutive bp)

Key lesson: Always prioritize eliminating 3' complementarity in primer pairs, even if overall ΔG is acceptable. The 3' end is where primer extension initiates, making even weak complementarity (3-4 bp) problematic.

Practice tip: Use these examples as templates when checking your own primers. Test your sequences with our free Secondary Structure Predictor to get similar ΔG analysis and identify issues before ordering synthesis.

Real-World Applications: When Secondary Structure Analysis Matters Most

PCR Primer Design

Secondary structure analysis is critical for PCR success. Primers with hairpins at the 3' end significantly reduce amplification efficiency and can cause PCR failure. Hetero-dimers between primer pairs are the leading cause of primer-dimer artifacts in gel electrophoresis.

Best practice: Always check both individual primers and primer pairs. Pay special attention to the last 3-5 bases at the 3' end, as complementarity here prevents polymerase extension. Combine structure analysis with accurate Tm calculation using nearest-neighbor method and GC analysis across pooled sequences for comprehensive primer validation.

See our complete PCR Primer Design workflow for step-by-step guidance.

CRISPR Guide RNA Design

CRISPR guide RNAs (sgRNAs) must maintain proper secondary structure for efficient Cas9/Cas12 binding and target recognition. Hairpins in the guide sequence can prevent proper RNP complex formation, substantially reducing editing efficiency in affected sequences.

Key considerations: Analyze structures at 37°C (physiological temperature). Guides with ΔG < -4 kcal/mol for hairpins typically show reduced activity. Self-dimers can also interfere with guide loading into Cas proteins.

For library-scale design, use Batch Sequence QC tool for pool-scale validation combined with structure prediction to filter problematic guides. See our complete CRISPR guide RNA library design workflow.

qPCR Probe Design

Fluorescent probes for qPCR must maintain linear structure during hybridization. Secondary structures reduce probe binding efficiency and cause increased background fluorescence, leading to inaccurate quantification.

Critical factors: Analyze at hybridization temperature (typically 60-65°C). Probes with hairpins involving the fluorophore or quencher attachment sites are particularly problematic. Self-dimers can cause false-positive signals.

For multiplex qPCR, check all probe combinations for hetero-dimers that could cause cross-talk between channels.

Oligo Pool Quality Control

Large oligonucleotide pools (hundreds to thousands of sequences) require batch structure analysis to identify problematic sequences before synthesis. Even a small percentage of sequences with strong secondary structures can compromise pool performance.

Workflow: Use Batch Sequence QC for automated pool validation to analyze entire pools, filter sequences with ΔG below thresholds, and redesign or exclude problematic sequences. This is especially critical for NGS library preparation and multiplexed assays.

See our step-by-step Oligo Pool Quality Control workflow for comprehensive pool validation strategies including structure checks, Tm validation, and cross-reactivity analysis.

Frequently Asked Questions

What are secondary structures and why do they matter?

Secondary structures are stable conformations that oligonucleotides can adopt through intramolecular or intermolecular base pairing. They include:

  • Hairpins: Sequences that fold back on themselves, forming stem-loop structures
  • Self-dimers: A sequence binding to itself through complementary regions
  • Hetero-dimers: Two different sequences binding to each other (e.g., primer pairs)

These structures are problematic because they:

  • Prevent binding to target sequences (for primers and probes)
  • Reduce PCR efficiency and yield
  • Cause non-specific amplification
  • Interfere with hybridization assays
  • Reduce CRISPR guide RNA activity

Detecting and avoiding secondary structures is essential for successful oligonucleotide design.

How do I interpret ΔG (free energy) values?

ΔG (delta G, free energy change) indicates the stability of a secondary structure. More negative values indicate more stable (and problematic) structures:

  • ΔG > -3 kcal/mol: Weak structure, usually acceptable
  • ΔG -3 to -6 kcal/mol: Moderate stability, may cause issues
  • ΔG < -6 kcal/mol: Strong structure, likely problematic

Acceptable thresholds:

  • Hairpins: ΔG > -3 kcal/mol (preferably > -2 kcal/mol)
  • Self-dimers: ΔG > -5 kcal/mol (preferably > -3 kcal/mol)
  • Hetero-dimers: ΔG > -5 kcal/mol (preferably > -3 kcal/mol)

Structures with ΔG values below these thresholds should be redesigned or excluded from pools.

What temperature should I use for structure prediction?

The analysis temperature should match your experimental conditions:

  • PCR primers: Use annealing temperature (typically 55-65°C)
  • qPCR probes: Use hybridization temperature (typically 60-65°C)
  • CRISPR guides: Use 37°C (physiological temperature)
  • Hybridization assays: Use the actual hybridization temperature

Default: 37°C is a good default for general analysis, as it represents physiological conditions and is conservative (structures are more stable at lower temperatures).

Our Secondary Structure Predictor allows you to set custom temperatures to match your specific experimental conditions.

How do I fix sequences with problematic secondary structures?

Several strategies can help resolve secondary structure issues:

  • Redesign the sequence: Change bases to break complementarity while maintaining function
  • Add mismatches: Introduce non-complementary bases in stem regions
  • Modify length: Shorten or lengthen the sequence to avoid problematic regions
  • Use modified bases: Locked nucleic acids (LNAs) or 2'-O-methyl bases can reduce structure formation
  • Adjust experimental conditions: Increase temperature or add denaturants (DMSO, formamide)

For primer pairs with hetero-dimers:

  • Redesign one or both primers to reduce complementarity
  • Ensure 3' ends don't have complementarity (most critical)
  • Use touchdown PCR to reduce dimer formation

After redesign, re-analyze the sequence to confirm structures are resolved.

Are secondary structures always problematic?

Not always. The impact depends on:

  • Structure stability: Weak structures (ΔG > -3 kcal/mol) may not interfere
  • Location: Structures at 3' ends are more problematic than internal structures
  • Application: Some applications are more tolerant than others
  • Experimental conditions: Higher temperatures or denaturants can reduce structure formation

Generally acceptable:

  • Weak hairpins (ΔG > -2 kcal/mol) away from 3' end
  • Moderate self-dimers (ΔG > -3 kcal/mol) not involving 3' end
  • Structures that form only at low temperatures

When in doubt, test experimentally or redesign to avoid potential issues.

How does this relate to PCR primer design?

Secondary structure analysis is critical for PCR primer design:

  • Hairpins: Can prevent primer binding to template, especially if at 3' end
  • Self-dimers: Reduce available primer concentration and cause non-specific products
  • Hetero-dimers: Cause primer-dimer artifacts, reducing target amplification

Best practices:

  • Check both forward and reverse primers individually
  • Check for hetero-dimers between primer pairs
  • Pay special attention to 3' ends (most critical for extension)
  • Use annealing temperature for analysis

Combine secondary structure checks with primer melting temperature (Tm) calculation and GC review across primer sets for comprehensive primer validation. See our PCR Primer Design workflow for complete guidance.

Supporting References

Our secondary structure prediction methods are based on established thermodynamic models and algorithms. For detailed information about the underlying calculations, visit our Scientific References page, which includes citations for key algorithms like the nearest-neighbor method for free energy calculation.

Authoritative sources on secondary structure prediction:

Note: The ΔG thresholds provided in this guide are based on empirical observations from thousands of oligonucleotide designs and align with industry-standard practices. Actual thresholds may vary slightly depending on specific experimental conditions and applications.

Algorithm Limitations & Accuracy

Secondary structure prediction algorithms, while highly accurate, have inherent limitations:

  • Predictions are based on thermodynamic equilibrium models and may not capture kinetic effects or transient structures
  • Actual structure formation depends on factors beyond ΔG: crowding agents, protein binding, solution viscosity, and reaction kinetics
  • Accuracy is highest for simple structures (hairpins, dimers) under standard conditions; complex multi-structure predictions may vary
  • Experimental validation is recommended for critical applications, especially for sequences near threshold ΔG values

Despite these limitations, nearest-neighbor thermodynamic models show >90% agreement with experimental structure determinations under standard conditions, making them reliable for primer design.

Related Tutorials & Resources

Ready to Detect Secondary Structures?

Use the Secondary Structure Predictor to identify problematic structures in your oligonucleotides, then return to this tutorial for interpretation and redesign context.

Open Secondary Structure Predictor →