Focus: Pre-order oligo pool QC checks

Oligo Pool QC Checklist Before Ordering

Intermediate45-90 minutes

Use this oligo pool QC checklist when you need to screen hundreds or thousands of oligos for synthesis risk before submitting a pool. It combines batch sequence validation, predicted error-rate review, and uniformity checks so you can catch dropout drivers, GC outliers, repeat-heavy sequences, and structure liabilities before ordering.

Need the focused QC walkthrough?

Use the walkthrough when you only need the hands-on execution steps. Stay on this page if you want the full QC guide, worked example, troubleshooting, and post-synthesis validation plan.

Page contents

Quick Takeaways

  • Five-part QC review: sequence preparation, batch QC, synthesis estimation, uniformity check, and export
  • Acceptable metrics: GC 30-70%, dropout <10%, CV <30%, sequencing depth 500-1000x
  • Batch processing supports up to 10,000 sequences with comprehensive validation
  • Predict synthesis success before ordering using error rate calculations
  • Reduce dropout by optimizing pool size, amount, and sequence composition
  • Post-synthesis NGS validation confirms predicted quality metrics

What Does Pre-Order Oligo Pool QC Actually Cover?

Large oligonucleotide pools—containing hundreds to thousands of unique sequences—are essential for modern molecular biology applications including next-generation sequencing (NGS) library preparation, CRISPR screening libraries, multiplex PCR assays, and high-throughput functional genomics. However, without proper quality control, these pools can suffer from high dropout rates, synthesis failures, and non-uniform representation that compromise experimental results.

Quality control for large oligo pools addresses three critical challenges: (1) sequence-level issues—identifying problematic sequences that fail synthesis or cause amplification bias; (2) synthesis efficiency—predicting how many sequences will be synthesized successfully; and (3) pool uniformity—ensuring all sequences are represented at similar concentrations after synthesis and amplification.

The cost of poor QC can be substantial. A pool with 20% dropout means 200 out of 1,000 sequences are missing, potentially invalidating entire experimental datasets. By implementing comprehensive QC checks before synthesis, researchers can identify and remove problematic sequences, optimize pool composition, and predict outcomes accurately—saving time, money, and experimental resources.

Why this guide is centered on pre-order screening

Modern oligo pool QC has evolved significantly from simple sequence checks. Early approaches relied on basic rules: avoid extreme GC content, limit homopolymers, ensure minimum length. Modern QC checks integrate sophisticated algorithms for batch sequence analysis, synthesis error modeling, uniformity prediction, and post-synthesis validation using next-generation sequencing.

Modern pre-order QC emphasizes predictive screening, using computational tools to forecast synthesis outcomes before ordering. This shift enables researchers to optimize pool design proactively, reducing the need for expensive re-synthesis and experimental troubleshooting. Advanced QC tools now account for modern synthesis technologies (array-based vs column-based), sequence complexity metrics, and statistical models for dropout prediction.

What Does a Real Pre-Order Pool QC Pass Look Like?

Scenario

You're designing a CRISPR sgRNA library targeting 500 genes. Each gene gets 1 sgRNA (20 nt guide + 80 nt scaffold = 100 nt total). You need to validate pool quality before ordering from Twist Bioscience (array-based synthesis).

Initial Pool Size

500 oligos

Oligo Length

100 nt

Synthesis Method

Array-based

1Run Batch Sequence QC

Upload 500 sequences to Batch Sequence QC tool

Flagged sequences:
- 15 sequences: GC content <30% or >70%
- 8 sequences: Homopolymers ≥4 bp
- 12 sequences: Strong secondary structures (ΔG < -5 kcal/mol)
- 3 sequences: Multiple issues (overlap)

Decision: Remove 32 flagged sequences (6.4% of pool)

Remaining: 468 sequences pass QC

2Estimate Synthesis Yield

Use Error Rate Calculator with parameters:

Oligo length: 100 nt
Synthesis method: Array-based
Coupling efficiency: 98.5% (typical for arrays)

Calculation: Full-length % = (0.985)^100 = 22.1%

This means ~22% of each oligo will be full-length, the rest will be truncated. For pooled CRISPR libraries, this is acceptable with downstream purification.

3Review Uniformity and Dropout Risk

Use Pool Uniformity Estimator:

Pool size: 468 sequences
Total amount ordered: 100 nmol (recommended for this pool size)
Expected amount per oligo: 100 nmol / 468 = 0.214 nmol each

Predicted metrics for array synthesis:

Expected dropout rate: 8-12% (typical for 500-size array pools)
Expected CV: 25-30% (acceptable for CRISPR screening)
Sequences expected to dropout: ~40-55 sequences

Interpretation: With 468 sequences ordered, expect ~420-430 sequences to be present at usable concentrations. This is acceptable for 500-gene coverage with some redundancy.

4Make the Ordering Decision

Review outcome

  • • 93.6% of sequences pass pre-synthesis QC (468/500)
  • • Expected post-synthesis success: ~88-92% (420-430/468)
  • • Final gene coverage: ~84-86% (420-430/500 genes)
  • • Synthesis quality (22% full-length) acceptable with purification

Order specifications

  • • Pool size: 468 sequences (after QC removal)
  • • Total amount: 100 nmol
  • • Format: FASTA file with sequence IDs matching gene names
  • • Special instructions: Request PAGE purification for full-length enrichment
  • • Estimated cost: ~$230-470 ($0.50-1.00 per oligo for this pool size)

Post-synthesis validation plan

  • • Perform NGS sequencing: MiSeq Nano (~1M reads, estimated $200-400 reagent cost)
  • • Target depth: 1,000-2,000× per sequence
  • • Validate actual dropout rate vs predicted 8-12%
  • • Identify any systematic failures (GC bias, specific sequence patterns)
  • • Document results to refine future QC thresholds

Review notes from this example

  • Pre-synthesis QC removed 6.4% of problematic sequences, preventing synthesis failures
  • Predictive modeling set realistic expectations: 84-86% final coverage vs 100% naive expectation
  • Adequate pool amount (100 nmol) provides ~0.21 nmol per oligo, reducing dropout risk
  • NGS validation budget ($200-300) is small compared to synthesis cost ($230-470)
  • PAGE purification improves full-length percentage from 22% to 60-80%, worth the added cost

What Are the Five Stages of a Full Pool QC Review?

Use this full review when you need to decide whether a pool is ready for vendor submission, which sequences should be redesigned, and how much dropout risk is still acceptable before you order.

1

Prepare Sequences

2

Batch QC

3

Estimate Quality

4

Check Uniformity

5

Export & Order

How Do You Run the QC Review Step by Step?

1

Prepare the Sequence Set for Batch Review

Format your sequences for batch analysis. Supported formats include FASTA, CSV, or plain text. Ensure sequences are clean (no ambiguous bases unless necessary) and properly labeled for traceability. For individual sequence validation, use Oligo Properties Calculator to check GC content, Tm, and molecular weight.

Format requirements

  • FASTA: Each sequence starts with >header, sequence on next line(s)
  • CSV: Columns: id, sequence (or name, sequence)
  • Plain Text: One sequence per line
  • Maximum: 10,000 sequences per batch
  • Remove ambiguous bases (N, R, Y, etc.) unless functionally required

Example FASTA Format:

>oligo_001
ATGCGTACGATCGATCGATCG
>oligo_002
GCTAGCTAGCTAGCTAGCTAG
2

Run Batch Sequence QC

Run comprehensive quality checks on all sequences using Batch Sequence QC. This tool analyzes thousands of sequences simultaneously, flagging problematic sequences based on multiple criteria including GC content, homopolymer runs, sequence complexity, and predicted secondary structures.

Run the review

  1. Navigate to Batch Sequence QC
  2. Upload your FASTA/CSV file or paste sequences directly
  3. Review flagged sequences: GC extremes, homopolymers, low complexity
  4. Export QC report (CSV or Excel format) for detailed analysis
  5. Document sequences removed and reasons for removal

QC Criteria Summary:

ParameterAcceptable RangeIdeal RangeAction if Out of Range
GC Content30-70%40-60%Remove or redesign
Homopolymers≤3 bp≤2 bpRemove if ≥4 bp
Sequence Length20-200 nt40-150 ntReview if outside range
Secondary Structure (ΔG)>-5 kcal/mol>-3 kcal/molRemove if ΔG <-5
ComplexityModerate-HighHighReview low complexity

Sequences that usually need redesign

  • 1. Extreme GC content (<20% or >80%) - verify with GC Content Analyzer
  • 2. Long homopolymers (AAAA, TTTT, GGGG, CCCC - 4+ repeats)
  • 3. Very low complexity (e.g., repetitive patterns)
  • 4. Sequences with predicted strong secondary structures (ΔG <-5 kcal/mol) - check with Secondary Structure Predictor
  • 5. Sequences shorter than 20 nt or longer than 200 nt (unless required)

Sequences that usually remain in the pool

  • GC content: 30-70% (ideal: 40-60%) - analyze with GC Analyzer
  • No homopolymers longer than 3 bp
  • Length: 20-200 nt (depending on synthesis method)
  • No strong secondary structures (ΔG > -5 kcal/mol)
  • Moderate to high sequence complexity
  • For primers, also check Tm consistency using Tm Calculator
3

Estimate Synthesis Yield Before Ordering

Predict expected synthesis success rate using the Error Rate Calculator. This tool models synthesis efficiency based on oligo length, coupling efficiency, and synthesis method (array-based vs column-based). Understanding expected full-length product percentages helps set realistic expectations and optimize pool design.

Estimate expected full-length yield

  1. Navigate to Error Rate Calculator
  2. Enter your average oligo length (or calculate from your sequences)
  3. Select synthesis method (array-based vs column-based)
  4. Enter coupling efficiency (default: 98.5% for arrays, 99.5% for columns)
  5. Review expected full-length product percentage
  6. Compare results across different length ranges if pool is heterogeneous

Typical Synthesis Quality Results:

MethodOligo LengthCoupling EfficiencyFull-Length %Application Suitability
Array-Based100 nt98.5%~22%Acceptable with purification
Array-Based150 nt98.5%~8%Requires purification or redundancy
Array-Based200 nt98.5%~4%Not recommended without purification
Column-Based100 nt99.5%~61%Excellent for most applications
Column-Based150 nt99.5%~47%Good for most applications
Column-Based200 nt99.5%~37%Acceptable with purification

* Full-length product percentage decreases exponentially with length. Array-based synthesis is cost-effective for large pools but requires downstream purification or design redundancy. Column-based synthesis offers higher quality but at higher cost.

Vendor Checks Before You Approve a Pool Order:

Use this table as a QC-planning checklist, not a vendor-selection source of truth. For current public specs, open the vendor specifications review and then shortlist vendors on the oligo pool vendor comparison.

QuestionWhy It MattersWhere to Verify
Does the public page document your length and pool-size tier?Length, pool size, and chip capacity control whether the order is eligible before QC review.Vendor specification page, then vendor quote
What QC deliverable is included or quoted separately?A QC promise is only useful if it names the metric, depth, report format, and raw data availability.Quote terms and QC report scope
Can you get per-sequence read counts or distribution data?Uniformity and dropout decisions need distribution data, not only a summary pass/fail statement.QC package, NGS report, or add-on service
Does turnaround cover production only or delivery-ready material?QC review and shipping can change when the pool is usable, especially with add-on validation.Vendor quote and ordering checklist
Will borderline sequences be rejected, synthesized, or flagged?A vendor policy can change whether you redesign before ordering or rescue after delivery.Vendor format rules and order review notes

When the yield estimate is low

  • Low full-length percentages (<10% for arrays) mean most oligos will be truncated
  • This is acceptable for pooled applications IF you use downstream purification (PAGE, HPLC)
  • Design with redundancy (multiple oligos per target) to compensate for dropout
  • For applications requiring high purity, consider column-based synthesis or shorter oligos
  • Factor synthesis quality into experimental design and statistical power calculations
4

Check Pool Uniformity and Dropout Risk

Estimate expected uniformity and dropout rate using the Pool Uniformity Estimator. Uniformity metrics predict how evenly sequences will be represented after synthesis and amplification. Poor uniformity leads to biased results and reduced experimental power, making this step critical for large pools.

Estimate representation risk

  1. Navigate to Pool Uniformity Estimator
  2. Enter pool size (number of unique oligos after QC)
  3. Enter total amount (nmol or µg) you plan to order
  4. Select synthesis method (affects expected uniformity)
  5. Review predicted dropout rate and uniformity metrics
  6. Adjust pool size or amount if dropout rate is unacceptable

Uniformity Quality Standards:

MetricExcellentAcceptablePoor (Action Required)
Dropout Rate<5%5-10%>10%
Coefficient of Variation (CV)<20%20-30%>30%
Sequencing Depth>1000x500-1000x<500x
Coverage Uniformity>90% at 100x80-90% at 100x<80% at 100x

Uniformity indicators to confirm

  • Dropout rate: <10% (acceptable), <5% (excellent)
  • Coefficient of variation (CV): <30% (acceptable), <20% (excellent)
  • Minimum sequencing depth: 500-1000x per oligo for validation
  • Coverage uniformity: >80% of sequences at 100x depth
  • Even distribution across GC content ranges

Signals that need review before ordering

  • Dropout rate: >20% → Too many sequences, insufficient amount
  • High CV: >50% → Synthesis bias or insufficient mixing
  • Low sequencing depth: <100x → Inadequate for QC validation
  • Skewed GC distribution → GC bias in synthesis or amplification
  • Uneven coverage → Systematic bias requiring investigation
5

Finalize the Ordering Export

Compile all QC results and prepare final sequences for synthesis order. This step ensures all quality checks are complete, documentation is thorough, and sequences are formatted correctly for your chosen vendor. Proper documentation facilitates post-synthesis validation and troubleshooting.

Final QC Checklist:

All problematic sequences removed or redesigned
Synthesis quality estimates reviewed and acceptable
Uniformity predictions within acceptable range
Final sequence count within budget and synthesis capacity
Sequences formatted correctly for vendor requirements
QC report saved for post-synthesis validation
Metadata (IDs, gene names) preserved in export

Export formats

  • FASTA: Standard format for most vendors, includes headers and sequences
  • CSV: Include metadata (IDs, gene names, QC metrics) for tracking
  • Excel: Comprehensive QC report with all metrics and flags
  • Vendor Format: Check vendor requirements - major providers include Twist, IDT, Agilent, GenScript (see vendor comparison table above)
  • NGS Libraries: For library prep applications, see our NGS Library Preparation guide

How Do You Validate the Pool After Synthesis?

Next-generation sequencing (NGS) validation is the most informative routine method for verifying oligo pool quality after synthesis. This protocol quantifies actual dropout rates, identifies failed sequences, validates uniformity predictions, and provides data for refining future QC checks.

Recommended for: Pools >100 sequences, critical applications requiring >95% success rate, method development, and vendor qualification.

NGS QC Steps

1

Library Preparation

Add Illumina adapters via PCR (8-12 cycles max to minimize bias)

Input amount: 10-100 ng of oligo pool

Indexing: Use unique barcodes for multiplexing

Purification: AMPure XP beads (0.8×) to remove primer dimers

2

Sequencing Parameters

Platform: Illumina MiSeq, NextSeq, or NovaSeq

Read length: Match oligo length (e.g., 2×150 for 100-200 nt oligos)

Depth: Target 500-1000× per unique oligo minimum

PhiX spike-in: 5-10% for quality control

3

Data Analysis

Quality filtering: Q30 > 80%, remove low-quality reads

Adapter trimming: Cutadapt or Trimmomatic

Alignment: Bowtie2 or BWA to reference sequences

Count quantification: HTSeq or custom scripts

4

Metrics Calculation

Dropout rate: % of sequences with <10 reads

CV calculation: (StdDev / Mean) × 100

Coverage uniformity: % at 100× depth threshold

GC bias analysis: Coverage vs GC content plot

Sequencing Depth Calculation

Formula:
Required Reads = (Pool Size × Target Depth) / (1 - Dropout Rate)
Example for 1,000-oligo pool at 1,000× depth with 10% dropout:
Required Reads = (1,000 × 1,000) / (1 - 0.10) = 1,111,111 reads

Estimated reagent cost: MiSeq Nano (~1M reads): ~$200-400 | MiSeq v2 (~15M reads): ~$600-1000 (varies by region and volume)

Multiplexing strategy: Pool multiple samples with unique barcodes to reduce per-sample cost

Interpreting NGS Results

ObservationLikely CauseAction
High dropout (>20%)Synthesis failure, insufficient amountIncrease pool amount, reduce pool size, tighten pre-QC
High CV (>50%)Amplification bias, synthesis biasReduce PCR cycles, optimize annealing temp, use digital PCR
GC-rich oligos under-representedPCR bias, synthesis coupling inefficiencyUse GC-enhanced polymerase, lower annealing temp
AT-rich oligos over-representedPreferential amplificationIncrease annealing temp, reduce extension time
Specific sequences always failSecondary structure, synthesis difficultyRedesign sequences, check for hairpins/dimers

Recommended QC Plots

  • 1. Read count distribution histogram: Shows uniformity, identifies outliers
  • 2. Coverage vs GC content scatter: Reveals GC bias in synthesis/amplification
  • 3. Rank-order plot: Expected (uniform) vs observed counts, visualizes dropout
  • 4. Lorenz curve: Quantifies representation inequality (Gini coefficient)
  • 5. Per-base quality heatmap: Identifies positional synthesis errors

Tools: R (ggplot2), Python (matplotlib/seaborn), or specialized packages like QoRTs for NGS QC

Best Practices for Large Oligo Pool QC

Pre-QC During Design

Design sequences with QC criteria in mind from the start. Use design algorithms that incorporate GC content limits, homopolymer avoidance, and secondary structure prediction. This reduces the need for redesign and removal later, saving time and improving pool quality.

Validate Post-Synthesis

Always perform NGS QC after synthesis to verify actual uniformity and identify sequences that failed synthesis. Compare predicted vs actual dropout rates to refine QC thresholds. Document discrepancies to improve future predictions.

Monitor Key Metrics

Track dropout rate, GC distribution, and uniformity across multiple pools to identify systematic issues with your design process. Maintain QC databases to learn which sequence features correlate with synthesis success in your applications.

Balance Quality vs. Cost

Stricter QC reduces dropout but may remove functional sequences. Adjust thresholds based on your application's tolerance for dropout. For critical applications, prioritize quality; for exploratory screens, accept higher dropout to maximize coverage.

Iterative Refinement

Use post-synthesis validation results to refine QC criteria. If certain sequence features consistently fail, tighten thresholds. If borderline sequences perform well, consider relaxing criteria to maximize pool diversity.

Document Everything

Maintain detailed records of QC decisions, removed sequences, predicted metrics, and actual results. This documentation enables troubleshooting, method refinement, and reproducibility across projects and collaborators.

Understanding Dropout at the Molecular Level

Sequence dropout and synthesis failure occur through well-defined chemical mechanisms. Understanding these molecular processes enables rational design choices and explains why certain QC thresholds exist.

Primary Synthesis Failure Modes

Coupling Inefficiency

Each phosphoramidite coupling cycle has ~98.5-99.5% efficiency. Failed couplings result in chain termination or deletion sequences. The probability of full-length synthesis is (coupling efficiency)^n where n = oligo length.

GC-dependent variation: Guanine (G) and cytosine (C) couple less efficiently than adenine (A) and thymine (T) due to stronger base stacking and secondary structure formation during synthesis. GC-rich sequences show 0.2-0.5% lower coupling efficiency, exponentially impacting full-length yield.

Depurination Events

Acid-labile glycosidic bonds between purines (A, G) and deoxyribose can cleave during deprotection steps. Depurination creates abasic sites that cause strand breaks, particularly in homopurine runs.

Why limit homopolymers: Runs of AAA or GGG substantially increase depurination probability with each additional base. Homopolymers ≥6 bp show significantly higher synthesis failure rates compared to mixed sequences, with reported increases of one order of magnitude or more in some studies.

Secondary Structure Interference

Strong intramolecular base pairing (hairpins, self-dimers) sterically hinders phosphoramidite access to the 5'-hydroxyl group. Structures with ΔG < -5 kcal/mol at synthesis temperature (room temp) reduce coupling efficiency by 5-20%.

Temperature factor: Synthesis occurs at ~25°C where secondary structures are more stable than physiological 37°C. Sequences acceptable in vivo may fail synthesis due to fold stability at lower temperatures.

Capping Failure and Deletion Sequences

Uncapped failure sequences (where coupling failed but capping also failed) continue through synthesis cycles, creating deletion mutants (n-1, n-2, etc.). These deletion products compete during amplification, reducing target representation.

Array vs column synthesis: Array synthesis has ~1-2% capping failure rate vs <0.1% for column synthesis, explaining higher deletion product prevalence in array-synthesized pools.

Why GC Content Matters: Thermodynamic Basis

GC Content vs Synthesis Success Rate

0%30%50%70%100%GC Content (%)0%25%50%75%100%Success Rate (%)Peak: 40-60% GCAT-richPoorAcceptableOPTIMALAcceptableGC-richPoor

Synthesis success rate shows a bell-shaped relationship with GC content. Extreme GC values (<30% or >70%) significantly reduce synthesis efficiency due to thermodynamic and kinetic factors.

GC-Rich Sequences (>70%)

  • 3 hydrogen bonds per GC pair vs 2 for AT → stronger stacking
  • Higher Tm: +0.5°C per GC→AT swap, causing synthesis issues
  • Aggregation: GC-rich oligos form intermolecular G-quartets
  • PCR bias: Under-amplified in standard PCR conditions
  • Synthesis failure: Significantly higher dropout vs balanced GC (reported 2-5× in literature)

AT-Rich Sequences (<30%)

  • Lower Tm: Unstable during primer annealing steps
  • Homopolymer tendency: AT runs more common, depurination risk
  • PCR bias: Over-amplified, dominate pool composition
  • Synthesis issues: TTT/AAA runs increase deletion frequency
  • Uniformity impact: Skew final pool distribution

Optimal GC range (40-60%): Balances synthesis efficiency, thermodynamic stability, and amplification uniformity. Within this range, coupling efficiency is ~99.0±0.2%, secondary structures are minimal (ΔG > -3 kcal/mol typical), and PCR bias is <2-fold.

Quantitative Dropout Prediction Model

Dropout probability for a given sequence can be modeled as a function of multiple factors:

Dropout Probability (Pdropout) =
Psynthesis_fail + Pamplification_fail + Psequence_loss
Where:
Psynthesis_fail = 1 - (ηcoupling)n × (1 - Pdepurination)
Pamplification_fail = f(GC, Tm, structure)
Psequence_loss = concentration_effect × pool_size_factor

Example calculation for problematic sequence:
100 nt, GC=75%, 4-bp G-run, ΔG=-6 kcal/mol hairpin
• Psynthesis_fail ≈ 1 - (0.983)^100 = 83% (reduced coupling from GC+structure)
• Pamplification_fail ≈ 40% (GC bias in PCR)
• Combined dropout ≈ 92% → Almost certain failure

Example for optimal sequence:
100 nt, GC=50%, no homopolymers >3 bp, ΔG=-2 kcal/mol
• Psynthesis_fail ≈ 1 - (0.9985)^100 = 14% (high coupling)
• Pamplification_fail ≈ 5% (minimal bias)
• Combined dropout ≈ 18% → 82% success probability

What Should You Do When the QC Results Look Bad?

Problem: High Dropout Rate (>20%)

High dropout indicates insufficient representation of sequences in the pool. This compromises experimental power and can invalidate results.

Solutions:

  • Reduce pool size (fewer sequences = more amount per oligo)
  • Order more total amount (e.g., 100 nmol instead of 50 nmol)
  • Remove sequences with extreme GC or homopolymers before synthesis
  • Consider column-based synthesis for critical sequences
  • Use equimolar pooling with concentration normalization

Problem: Many Sequences Flagged in QC

If a large proportion of sequences fail QC, the design rules may need adjustment or thresholds may be too strict.

Solutions:

  • Relax QC thresholds if sequences are borderline (e.g., GC 29% instead of 30%)
  • Redesign sequences with alternative algorithms or parameters
  • Accept flagged sequences if they're functionally necessary (monitor closely)
  • Review design constraints that may be causing systematic issues
  • Consider application-specific tolerance for suboptimal sequences

Problem: Poor Uniformity (High CV)

High coefficient of variation indicates uneven representation, leading to biased results and reduced statistical power.

Solutions:

  • Ensure adequate mixing during resuspension (vortex, pipette mixing)
  • Use equimolar pooling (normalize concentrations before pooling)
  • Reduce PCR cycles if amplifying before use (PCR bias)
  • Consider digital PCR for more uniform amplification
  • Investigate GC bias in synthesis or amplification steps
  • Increase sequencing depth to compensate for uneven coverage

Problem: Discrepancy Between Predicted and Actual Dropout

If actual dropout significantly exceeds predictions, synthesis conditions or QC models may need adjustment.

Solutions:

  • Review synthesis vendor specifications and actual coupling efficiency
  • Check for vendor-specific issues (contact vendor if dropout is unusually high)
  • Validate QC predictions with pilot pools before large orders
  • Adjust error rate calculator parameters based on historical data
  • Consider vendor-specific synthesis characteristics in predictions

Frequently Asked Questions About Pre-Order Pool QC

What is quality control for large oligo pools?
Quality control for large oligo pools is a comprehensive process of validating thousands of oligonucleotide sequences before synthesis. It involves batch sequence analysis to identify problematic sequences (GC extremes, homopolymers, secondary structures), predicting synthesis success rates, and estimating pool uniformity to ensure experimental success. This proactive QC approach minimizes dropout, reduces synthesis failures, and optimizes pool composition for large-scale applications like NGS library preparation and CRISPR screening.
How do you perform QC on large oligo pools?
Perform QC using five steps: (1) Prepare sequences in FASTA/CSV format, (2) Run Batch Sequence QC to flag problematic sequences, (3) Use Error Rate Calculator to predict synthesis success, (4) Check Pool Uniformity Estimator for dropout rates, and (5) Export validated sequences for synthesis. Each step addresses different aspects of pool quality, ensuring comprehensive validation before ordering.
What are acceptable QC metrics for oligo pools?
Acceptable QC metrics include: GC content 30-70% (ideal 40-60%), no homopolymers longer than 3 bp, dropout rate <10% (excellent <5%), coefficient of variation <30% (excellent <20%), and minimum sequencing depth 500-1000x per oligo for validation. Sequences should have no strong secondary structures (ΔG > -5 kcal/mol) and moderate to high complexity. These thresholds balance quality with practical constraints, but can be adjusted based on application-specific requirements.
How do you reduce dropout rate in oligo pools?
Reduce dropout by: decreasing pool size (fewer sequences = more amount per oligo), ordering more total amount (e.g., 100 nmol vs 50 nmol), removing extreme GC or homopolymer sequences before synthesis, using column-based synthesis for critical sequences, ensuring adequate mixing during resuspension, using equimolar pooling with concentration normalization, and reducing PCR cycles if amplifying before use to minimize amplification bias.
What tools are needed for oligo pool QC?
Essential tools include Batch Sequence QC for sequence validation, Error Rate Calculator for synthesis prediction, Pool Uniformity Estimator for dropout assessment, GC Content Analyzer for composition checks, and Secondary Structure Predictor for folding analysis. These tools work together to provide comprehensive QC coverage.
How do you validate oligo pool quality after synthesis?
Validate post-synthesis using NGS sequencing to verify actual uniformity, identify failed sequences, compare predicted vs actual dropout rates, assess GC distribution, and calculate coefficient of variation. Minimum 500-1000x sequencing depth per oligo is recommended for reliable validation. Compare results to pre-synthesis predictions to refine QC models and improve future pool designs. Document discrepancies to build institutional knowledge about synthesis performance.

Supporting References

Our QC checks are based on established scientific methods and algorithms. For detailed information about the underlying calculations, visit our Scientific References page, which includes citations for key algorithms like the SantaLucia nearest-neighbor method for Tm calculation and synthesis error modeling approaches.

For authoritative information on oligo pool design and QC principles, consult established protocols such as those published by NCBI protocols and molecular biology handbooks. Large-scale oligo pool synthesis and QC methods are documented in publications from leading research institutions, including guidance from Addgene CRISPR resources and NGS library preparation protocols from sequencing platform manufacturers.

Related QC pages

Use the adjacent guide or calculator that fits the part of the pool review you need to check next.

Start the Pre-Order Oligo Pool QC Review

Begin with Batch Sequence QC to validate the sequence set, then use Pool Uniformity Estimator and Error Rate Calculator to review dropout and synthesis risk before submission. If you already know the decision, switch to the pool QC walkthrough. Need help? You can also for personalized guidance.