1. Which QC Checks Matter Before Ordering an Oligo Pool?
Quality control for oligonucleotide pools validates sequences before synthesis to prevent experimental failures. Pool QC differs from single-oligo validation by requiring uniform properties across hundreds to thousands of sequences while ensuring synthesis compatibility and experimental reproducibility.
- Individual sequence quality: Each sequence passes thermodynamic and compositional thresholds
- Pool uniformity: GC content SD <2%, Tm range <10°C, length variation <20%
- Synthesis compatibility: No homopolymers >4bp, secondary structures ΔG >-3 kcal/mol
- Multiplex compatibility: Sequences avoid cross-hybridization (analyzed with Primer Analyzer)
Pre-Order Oligo Pool QC
Workflow Overview: Input sequences → Batch validation → Pass/Fail decision → Export or redesign → Iterate until >95% pass rate
Industry-Standard QC Metrics
1. GC Content Analysis (use GC Content Analyzer)
- Acceptable range: 40-60% (individual sequences)
- Pool uniformity: Mean 45-55%, standard deviation <2%
- Critical flags: <30% or >70% (synthesis failure risk >50%)
- NGS libraries: Maintain ±2% GC for uniform PCR amplification
2. Melting Temperature Validation (use Tm Calculator)
- Calculation method: Nearest-neighbor thermodynamics (SantaLucia & Hicks 2004, Annu. Rev. Biophys. Biomol. Struct. - most accurate unified parameters)
- PCR primers: 55-65°C (±3°C within pool)
- qPCR/hybridization: 60-70°C (±2°C for multiplex)
- Pool uniformity: <10°C range, <3°C SD optimal
- Salt conditions: Validate at experimental [Na+] (typically 50mM), use Owczarzy 2008 salt correction for accuracy
3. Homopolymer Detection
- Critical threshold: No runs >4bp (synthesis error rate increases 5-10x)
- Poly-A/T runs: Flag >3bp (array synthesis slippage)
- Poly-G runs: Flag >3bp (secondary structure formation)
- Cost impact: Homopolymer failures waste $200-500 per 96-well plate
4. Secondary Structure Analysis (use Secondary Structure Predictor)
- Hairpin threshold: ΔG >-3 kcal/mol (stable structures inhibit synthesis)
- Self-dimer threshold: ΔG >-5 kcal/mol (critical for PCR)
- Stem-loop structures: Flag stems >4bp with loops <3nt
- Analysis conditions: Validate at synthesis temperature (37°C) and experimental temperature
5. Sequence Complexity & Composition
- Low complexity: Flag dinucleotide repeats (AT/TA, GC/CG) >6bp
- Base balance: Each base 15-40% of total sequence
- 3' end stability: Last 5bp should have balanced GC (40-60%)
- Forbidden motifs: Check for restriction sites, adapter sequences
6. Pool Uniformity Metrics (use Pool Uniformity Estimator)

- Gini Coefficient: Target <0.15 for high uniformity in array synthesis. A Gini coefficient >0.25 indicates heavy pooling bias.
- Coefficient of variation (CV): <15% for GC content, Tm, length
- Outlier threshold: Flag sequences >2 SD from mean
- Synthesis yield prediction: Uniform pools: 80-95% yield; non-uniform: 30-60%
- NGS coverage uniformity: CV <20% ensures <3-fold representation bias
Quick Reference: Application-Specific QC Thresholds
Based on industry standards and vendor specifications (2026)
| Parameter | PCR Primers | qPCR Probes | CRISPR sgRNA | NGS Adapters | Oligo Pools |
|---|---|---|---|---|---|
| GC Content | 40-60% Optimal: 50% | 40-60% Strict ±5% | 40-60% Optimal: 50-55% | 45-55% Balanced required | 45-55% mean SD <2% |
| Tm Range | 55-65°C Pool: ±3°C | 60-70°C Pool: ±2°C | N/A Not critical | Matched Pool: ±2°C | Application-dep. Range <10°C |
| Length | 18-25 bp 20-22 bp ideal | 18-30 bp Probe-specific | 19-21 bp 20 bp standard | 18-25 bp Fixed per design | 40-200 bp CV <10% |
| Homopolymers | <4 bp No poly-G >3 | <4 bp Strict | <4 bp No poly-T >4 | <4 bp Critical | <4 bp Array: <4 strict |
| Secondary Structures | ΔG >-3 kcal/mol Hairpins critical | ΔG >-2 kcal/mol Very strict | ΔG >-3 kcal/mol Check carefully | ΔG >-4 kcal/mol Moderate | ΔG >-3 kcal/mol Pool average |
| 3' Stability | GC clamp (2-3bp) Required | No G at 5' end Quenching | Balanced Not critical | Balanced GC 40-60% | Variable Application-dep. |
| Critical QC Focus | Tm uniformity, dimers | Structures, Tm precision | Poly-T, off-targets | Edit distance, balance | Uniformity, outliers |
Note: Thresholds based on Illumina (2023), IDT (2026), Twist Bioscience (2026) technical specifications, and ISO 20395:2019 recommendations. Use Batch Sequence QC to validate against these thresholds.
2. How Do You Run Batch Sequence QC on a Large Sequence Set?
Step 1: Prepare Your Sequences
Format sequences in FASTA format. Each sequence should have a header line starting with">" followed by an identifier, and one or more lines containing the nucleotide sequence.
ATCGATCGATCGATCGATCG
GCTAGCTAGCTAGCTAGCTA
ATATATATATATATATATAT
Ensure sequences contain only valid nucleotides (A, T, C, G for DNA; A, U, C, G for RNA). Remove any formatting characters, spaces, or ambiguous bases before QC.
Step 2: Access Batch QC Tool
Navigate to the Batch Sequence QC tool. This tool is specifically designed for comprehensive quality control of large sequence sets.
Step 3: Input Sequences
You can input sequences in two ways:
- Paste sequences: Copy and paste FASTA-formatted sequences directly
- Upload file: Click"Upload File" and select a .txt or .fasta file
The tool supports up to 10,000 sequences per batch. For larger pools, split into multiple batches.
Step 4: Configure QC Thresholds
Set appropriate thresholds for your application:
Standard Thresholds (Most Applications):
- GC Content: 40-60% (flag <30% or >70%)
- Melting Temperature: 55-65°C (flag outside range)
- Length: 18-30 bp (flag outside range)
- Homopolymers: Flag runs of 4+ identical bases
- Secondary Structures: Flag hairpins (ΔG < -3 kcal/mol) and dimers (ΔG < -5 kcal/mol)
Application-Specific Adjustments:
- qPCR: Tighter Tm range (60-65°C), stricter secondary structure requirements
- CRISPR: Length 19-21 bp, check secondary structures carefully
- Oligo pools: Focus on uniformity, flag outliers
Step 5: Run QC Analysis
Click"Run QC" to start analysis. The tool will:
- Validate sequence format and composition
- Calculate GC content for each sequence
- Calculate melting temperatures
- Check for homopolymers and repeats
- Predict secondary structures
- Flag sequences that fail any threshold
- Generate summary statistics
Processing time depends on pool size. Most batches process in 30-120 seconds.
Step 6: Review Results

The results panel displays:
Summary Statistics:
- Total sequences analyzed
- Number of sequences passing all thresholds
- Number of sequences flagged (and reasons)
- GC content distribution (mean, median, range)
- Tm distribution (mean, median, range)
Flagged Sequences:
- List of sequences that failed thresholds
- Specific reasons for each flag (GC, Tm, homopolymer, structure, etc.)
- Severity indicators (warning vs. critical)
Pool Uniformity Metrics:
- GC content standard deviation (lower is better)
- Tm range (smaller is better for uniformity)
- Distribution histograms
Step 7: Take Action on Flagged Sequences
For each flagged sequence, decide:
- Accept: Minor issues may be acceptable for your application
- Redesign: Modify sequence to meet thresholds
- Exclude: Remove non-critical sequences
After fixing sequences, re-run QC to confirm all sequences pass thresholds.
Step 8: Export Results
Export QC results as CSV for:
- Documentation and record-keeping
- Further analysis in Excel or R
- Integration with synthesis orders
- Tracking QC history
The CSV includes all sequence information, QC results, and flags for easy filtering and analysis.
3. What Does a Real QC Iteration Look Like on a CRISPR Library?

Example: 1,000 Sequence CRISPR Screening Library
Initial QC Results (Iteration 1)
- Total sequences:1,000
- Sequences passed:847 (84.7%)
- Sequences flagged:153 (15.3%)
- Failure breakdown:
- GC content issues:62 (6.2%)
- Homopolymer runs >4bp:51 (5.1%)
- Poly-T terminator (TTTT):28 (2.8%)
- Secondary structures:12 (1.2%)
Pool Uniformity Metrics
- Mean GC content:52.3%
- GC standard deviation:4.1% (target: <2%)
- Mean Tm:58.7°C
- Tm range:16.2°C (target: <10°C)
- Length (all sequences):20 bp
- Coefficient of variation:18.3% (target: <15%)
Remediation Actions Taken
- GC content optimization (62 sequences): Adjusted wobble positions in coding sequences, substituted AT-rich regions with GC bases where functionally acceptable. 58 sequences corrected, 4 excluded.
- Homopolymer disruption (51 sequences): Broke poly-A/T runs by inserting G/C at position +2 or +3 of runs. All 51 sequences successfully redesigned.
- Poly-T terminator removal (28 sequences): Critical for CRISPR - replaced T bases to avoid transcription termination. 27 sequences corrected, 1 target excluded (no viable alternative).
- Secondary structure disruption (12 sequences): Modified stem sequences to break complementarity, validated with Structure Predictor. All 12 corrected.
Final QC Results (Iteration 2)
- Total sequences:995 (5 excluded)
- Sequences passed:967 (97.2%)
- Sequences flagged:28 (2.8%)
- Target >95% achieved
Improved Uniformity
- GC standard deviation:1.8% (within target)
- Tm range:8.3°C (within target)
- Coefficient of variation:11.2% (within target)
- All metrics within target
Outcome: Pool synthesized by Twist Bioscience (array synthesis). Post-synthesis NGS validation showed 98.1% of sequences present with median coverage CV of 17.2% (within acceptable range). Only 1.9% sequence dropout, significantly better than 5-10% typical for non-QC'd pools. Total QC time: 4.5 hours across 2 iterations. Estimated cost savings: $1,800 (avoided failed synthesis and 3-week re-synthesis delay).
4. Which QC Habits Reduce Synthesis Failures and Rework?
1. Implement Iterative QC During Design
Run QC at design stage (not pre-synthesis only) to enable rapid iteration. For pools >1,000 sequences, QC in batches of 500-1,000 during generation. Early QC reduces redesign time from days to hours and identifies systematic design flaws (e.g., biased GC distribution, repetitive motifs).
- Design checkpoint QC: 25%, 50%, 75%, 100% completion
- Real-time validation: Use Batch QC API integration for automated validation
- Cost-benefit: 2 hours QC iteration saves $500-2,000 in failed synthesis and 2-4 weeks project delay
2. Application-Specific Threshold Optimization
Start with platform-validated defaults, then optimize based on pilot data. Array synthesis (Agilent, Twist) requires stricter thresholds than column synthesis (IDT). NGS applications need tighter uniformity (GC SD <2%, Tm range <8°C) than PCR pools.
- Pilot synthesis: Test 96 sequences across parameter space before full pool
- Threshold refinement: Analyze synthesis yield vs. QC stringency to optimize cost/quality trade-off
- Platform consultation: Vendors provide application-specific QC guidelines (request from synthesis provider)
3. Prioritize Pool Uniformity Over Individual Perfection
For pools >100 sequences, uniformity metrics (CV, SD, range) predict experimental success better than individual sequence quality. Target: GC SD <2%, Tm range <10°C, length CV <10%. Exclude outliers >2 SD from mean even if individually"passing" to improve pool uniformity.
- Uniformity validation: Use Pool Uniformity Estimator for synthesis yield prediction
- Statistical QC: Calculate and track CV, SD, interquartile range for each parameter
- Outlier management: Remove sequences >2 SD from mean or modify to bring within 1.5 SD
4. Comprehensive Documentation for Reproducibility
Maintain QC documentation for troubleshooting, regulatory compliance (diagnostics/therapeutics), and method validation. Essential records: original sequences, QC parameters/thresholds, flagged sequences, modifications, re-QC results, final sequences, synthesis order details.
- Export formats: CSV from Batch QC, synthesis formats from Format Converter
- Version control: Track QC iterations (v1, v2, v3) with timestamps and modification rationale
- Regulatory compliance: ISO 20395:2019 (oligonucleotide QC standard), ISO 13485 (medical devices), FDA 21 CFR Part 11 (electronic records), CLIA/CAP (clinical diagnostics)
5. Integrated Multi-Tool QC Workflow
Comprehensive QC requires multiple specialized tools. Recommended workflow:
- Batch Sequence QC - primary validation (all parameters)
- GC Content Analyzer - distribution analysis and outlier detection
- Tm Calculator - thermodynamic validation with experimental salt conditions
- Secondary Structure Predictor - detailed structure analysis for flagged sequences
- Pool Uniformity Estimator - synthesis yield and coverage prediction
- Error Rate Calculator - synthesis quality metrics and cost estimation
- Format Converter - export to vendor-specific synthesis formats
See the full page on how to QC a large oligo pool before ordering with benchmarking data and troubleshooting guides.
QC Success Metrics
- Target pass rate: 95-98% after QC iteration (industry standard)
- Pool uniformity: GC SD <2%, Tm range <8°C, CV <12%
- Synthesis yield: >80% sequences with >50% expected yield
- NGS coverage: Median CV <20%, no sequences <10% median coverage
- Experimental success: <5% PCR failure rate, <10% NGS dropout
