Pre-Order Oligo Pool QC Tutorial for Batch Sequence Checks

Q: What is oligo pool QC and why is it important?

What is oligo pool QC and why is it important? - See full answer on page.

Q: What parameters should I check during QC?

What parameters should I check during QC? - See full answer on page.

Q: How do I set appropriate QC thresholds?

How do I set appropriate QC thresholds? - See full answer on page.

Q: How many sequences can I QC at once?

How many sequences can I QC at once? - See full answer on page.

Q: What should I do with flagged sequences?

What should I do with flagged sequences? - See full answer on page.

Q: How do I ensure pool uniformity?

How do I ensure pool uniformity? - See full answer on page.

Use this page when you need to screen a large oligo pool before submission, decide whether GC spread, Tm variation, homopolymers, or secondary structures are severe enough to trigger redesign, and know which checks belong in a fast pre-order pass versus a deeper review. If you already know the next action, open the Batch Sequence QC, Pre-Order Oligo Pool QC Guide, GC Content Analyzer, Tm Calculator, and What QC Should I Request for Oligos?.

Key Takeaways

•Screen GC content, Tm spread, sequence length, homopolymers, secondary structures, sequence complexity, and base composition before synthesis submission
•Use application-specific thresholds instead of a single universal pass/fail rule for every oligo pool
•NGS library pools usually need tighter GC and Tm uniformity than small PCR primer pools
•Flag homopolymers, low-complexity repeats, and strong predicted structures before vendor review or ordering
•Batch validation helps compare thousands of sequences under one consistent set of thresholds
•Pool-level metrics such as GC standard deviation, Tm range, and coefficient of variation help identify outliers that single-sequence checks can miss

Questions this guide answers

Which QC thresholds matter before I submit a pool for synthesis? How do I run Batch Sequence QC on 1,000+ sequences? What does a QC review look like on a CRISPR library? Which QC habits reduce synthesis failures and redesign loops?

Useful follow-up checks

Open Batch Sequence QC for a direct pre-order pass Follow the full pre-order oligo pool QC guide Check whether GC spread is driving pool imbalance Compare Tm spread before finalizing the pool Estimate pool uniformity and dropout risk Review vendor QC requirements before ordering

Page contents

Scientist in a cleanroom examining NGS flow cell and quality control metrics on a tablet

Which QC Checks Matter Before Ordering an Oligo Pool?

Quality control for oligonucleotide pools validates sequences before synthesis to prevent experimental failures. Pool QC differs from single-oligo validation by requiring uniform properties across hundreds to thousands of sequences while ensuring synthesis compatibility and experimental reproducibility.

Individual sequence quality: Each sequence passes thermodynamic and compositional thresholds
Pool uniformity: GC content SD <2%, Tm range <10°C, length variation <20%
Synthesis compatibility: No homopolymers >4bp, secondary structures ΔG >-3 kcal/mol
Multiplex compatibility: Sequences avoid cross-hybridization (analyzed with Primer Analyzer)

Pre-Order Oligo Pool QC

QC Overview: Input sequences → Batch validation → Pass/Fail decision → Export or redesign → Iterate until >95% pass rate

Common Pre-Order QC Metrics

GC Content Analysis (use GC Content Analyzer)

Acceptable range: 40-60% (individual sequences)
Pool uniformity: Mean 45-55%, standard deviation <2%
Critical flags: <30% or >70% (synthesis failure risk >50%)
NGS libraries: Maintain ±2% GC for uniform PCR amplification

Melting Temperature Validation (use Tm Calculator)

Calculation method: Nearest-neighbor thermodynamics (SantaLucia & Hicks 2004, Annu. Rev. Biophys. Biomol. Struct.)
PCR primers: 55-65°C (±3°C within pool)
qPCR/hybridization: 60-70°C (±2°C for multiplex)
Pool uniformity: <10°C range, <3°C SD optimal
Salt conditions: Validate at experimental [Na+] (typically 50mM), use Owczarzy 2008 salt correction for accuracy

Homopolymer Detection

Critical threshold: No runs >4bp (synthesis error rate increases 5-10x)
Poly-A/T runs: Flag >3bp (array synthesis slippage)
Poly-G runs: Flag >3bp (secondary structure formation)
Cost impact: Homopolymer failures waste $200-500 per 96-well plate

Secondary Structure Analysis (use Secondary Structure Predictor)

Hairpin threshold: ΔG >-3 kcal/mol (stable structures inhibit synthesis)
Self-dimer threshold: ΔG >-5 kcal/mol (critical for PCR)
Stem-loop structures: Flag stems >4bp with loops <3nt
Analysis conditions: Validate at synthesis temperature (37°C) and experimental temperature

Sequence Complexity & Composition

Low complexity: Flag dinucleotide repeats (AT/TA, GC/CG) >6bp
Base balance: Each base 15-40% of total sequence
3' end stability: Last 5bp should have balanced GC (40-60%)
Forbidden motifs: Check for restriction sites, adapter sequences

Pool Uniformity Metrics (use Pool Uniformity Estimator)

Bioinformatics researcher analyzing GC content and Tm uniformity bell curves

Gini Coefficient: Target <0.15 for high uniformity in array synthesis. A Gini coefficient >0.25 indicates heavy pooling bias.
Coefficient of variation (CV): <15% for GC content, Tm, length
Outlier threshold: Flag sequences >2 SD from mean
Synthesis yield prediction: Uniform pools: 80-95% yield; non-uniform: 30-60%
NGS coverage uniformity: CV <20% ensures <3-fold representation bias

Quick Reference: Application-Specific QC Thresholds

Starting ranges to adapt for the synthesis provider and application

Parameter	PCR Primers	qPCR Probes	CRISPR sgRNA	NGS Adapters	Oligo Pools
GC Content	40-60% Optimal: 50%	40-60% Strict ±5%	40-60% Optimal: 50-55%	45-55% Balanced required	45-55% mean SD <2%
Tm Range	55-65°C Pool: ±3°C	60-70°C Pool: ±2°C	N/A Not critical	Matched Pool: ±2°C	Application-dep. Range <10°C
Length	18-25 bp 20-22 bp ideal	18-30 bp Probe-specific	19-21 bp 20 bp standard	18-25 bp Fixed per design	40-200 bp CV <10%
Homopolymers	<4 bp No poly-G >3	<4 bp Strict	<4 bp No poly-T >4	<4 bp Critical	<4 bp Array: <4 strict
Secondary Structures	ΔG >-3 kcal/mol Hairpins critical	ΔG >-2 kcal/mol Very strict	ΔG >-3 kcal/mol Check carefully	ΔG >-4 kcal/mol Moderate	ΔG >-3 kcal/mol Pool average
3' Stability	GC clamp (2-3bp) Required	No G at 5' end Quenching	Balanced Not critical	Balanced GC 40-60%	Variable Application-dep.
Critical QC Focus	Tm uniformity, dimers	Structures, Tm precision	Poly-T, off-targets	Edit distance, balance	Uniformity, outliers

Note: Thresholds based on Illumina (2023), IDT (2026), Twist Bioscience (2026) technical specifications, and ISO 20395:2019 recommendations. Use Batch Sequence QC to validate against these thresholds.

How Do You Run Batch Sequence QC on a Large Sequence Set?

Prepare Your Sequences

Format sequences in FASTA format. Each sequence should have a header line starting with">" followed by an identifier, and one or more lines containing the nucleotide sequence.

Example FASTA format:

>sequence_001
ATCGATCGATCGATCGATCG

>sequence_002
GCTAGCTAGCTAGCTAGCTA

>sequence_003
ATATATATATATATATATAT

Ensure sequences contain only valid nucleotides (A, T, C, G for DNA; A, U, C, G for RNA). Remove any formatting characters, spaces, or ambiguous bases before QC.

Open the Batch QC Tool

Navigate to the Batch Sequence QC tool. This tool is specifically designed for comprehensive quality control of large sequence sets.

Input Sequences

You can input sequences in two ways:

Paste sequences: Copy and paste FASTA-formatted sequences directly
Upload file: Click"Upload File" and select a .txt or .fasta file

The tool supports up to 10,000 sequences per batch. For larger pools, split into multiple batches.

Configure QC Thresholds

Set appropriate thresholds for your application:

Standard Thresholds (Most Applications):

GC Content: 40-60% (flag <30% or >70%)
Melting Temperature: 55-65°C (flag outside range)
Length: 18-30 bp (flag outside range)
Homopolymers: Flag runs of 4+ identical bases
Secondary Structures: Flag hairpins (ΔG < -3 kcal/mol) and dimers (ΔG < -5 kcal/mol)

Application-Specific Adjustments:

qPCR: Tighter Tm range (60-65°C), stricter secondary structure requirements
CRISPR: Length 19-21 bp, check secondary structures carefully
Oligo pools: Focus on uniformity, flag outliers

Run QC Analysis

Click"Run QC" to start analysis. The tool will:

Validate sequence format and composition
Calculate GC content for each sequence
Calculate melting temperatures
Check for homopolymers and repeats
Predict secondary structures
Flag sequences that fail any threshold
Generate summary statistics

Processing time depends on pool size. Most batches process in 30-120 seconds.

Review Results

Dark mode bioinformatics dashboard showing 10,000 sequences passing batch QC

The results panel displays:

Summary Statistics:

Total sequences analyzed
Number of sequences passing all thresholds
Number of sequences flagged (and reasons)
GC content distribution (mean, median, range)
Tm distribution (mean, median, range)

Flagged Sequences:

List of sequences that failed thresholds
Specific reasons for each flag (GC, Tm, homopolymer, structure, etc.)
Severity indicators (warning vs. critical)

Pool Uniformity Metrics:

GC content standard deviation (lower is better)
Tm range (smaller is better for uniformity)
Distribution histograms

Resolve Flagged Sequences

For each flagged sequence, decide:

Accept: Minor issues may be acceptable for your application
Redesign: Modify sequence to meet thresholds
Exclude: Remove non-critical sequences

After fixing sequences, re-run QC to confirm all sequences pass thresholds.

Export Results

Export QC results as CSV for:

Documentation and record-keeping
Further analysis in Excel or R
Integration with synthesis orders
Tracking QC history

The CSV includes all sequence information, QC results, and flags for easy filtering and analysis.

What Does a Real QC Iteration Look Like on a CRISPR Library?

Researcher examining a 384-well microplate with CRISPR-Cas9 molecular structure in background

CRISPR Screening Library Example

Initial QC Review

Total sequences:1,000
Sequences passed:847 (84.7%)
Sequences flagged:153 (15.3%)
Failure breakdown:
GC content issues:62 (6.2%)
Homopolymer runs >4bp:51 (5.1%)
Poly-T terminator (TTTT):28 (2.8%)
Secondary structures:12 (1.2%)

Pool Uniformity Metrics

Mean GC content:52.3%
GC standard deviation:4.1% (target: <2%)
Mean Tm:58.7°C
Tm range:16.2°C (target: <10°C)
Length (all sequences):20 bp
Coefficient of variation:18.3% (target: <15%)

Remediation Actions Taken

GC content optimization (62 sequences): Adjusted wobble positions in coding sequences, substituted AT-rich regions with GC bases where functionally acceptable. 58 sequences corrected, 4 excluded.
Homopolymer disruption (51 sequences): Broke poly-A/T runs by inserting G/C at position +2 or +3 of runs. All 51 sequences successfully redesigned.
Poly-T terminator removal (28 sequences): Critical for CRISPR - replaced T bases to avoid transcription termination. 27 sequences corrected, 1 target excluded (no viable alternative).
Secondary structure disruption (12 sequences): Modified stem sequences to break complementarity, validated with Structure Predictor. All 12 corrected.

Revised QC Review

Total sequences:995 (5 excluded)
Sequences passed:967 (97.2%)
Sequences flagged:28 (2.8%)
Most high-severity flags resolved

Improved Uniformity

GC standard deviation:1.8% (within target)
Tm range:8.3°C (within target)
Coefficient of variation:11.2% (within target)
Pool-level metrics moved within the selected targets

Interpretation: The second review leaves a smaller set of low-severity flags and brings GC spread, Tm range, and coefficient of variation closer to the project targets. Treat these numbers as an illustrative review pattern, then confirm acceptance criteria with the synthesis provider and downstream assay requirements.

Which QC Habits Reduce Synthesis Failures and Rework?

Implement Iterative QC During Design

Run QC at design stage (not pre-synthesis only) to enable rapid iteration. For pools >1,000 sequences, QC in batches of 500-1,000 during generation. Early QC reduces redesign time from days to hours and identifies systematic design flaws (e.g., biased GC distribution, repetitive motifs).

Design checkpoint QC: 25%, 50%, 75%, 100% completion
Consistent validation: Use Batch Sequence QC with the same thresholds across design iterations
Project planning: Early QC can reduce avoidable redesign, resynthesis, and schedule risk

Application-Specific Threshold Optimization

Start with platform-validated defaults, then optimize based on pilot data. Array synthesis (Agilent, Twist) requires stricter thresholds than column synthesis (IDT). NGS applications need tighter uniformity (GC SD <2%, Tm range <8°C) than PCR pools.

Pilot synthesis: Test 96 sequences across parameter space before full pool
Threshold refinement: Analyze synthesis yield vs. QC stringency to optimize cost/quality trade-off
Platform consultation: Vendors provide application-specific QC guidelines (request from synthesis provider)

Prioritize Pool Uniformity Over Individual Perfection

For pools >100 sequences, uniformity metrics (CV, SD, range) predict experimental success better than individual sequence quality. Target: GC SD <2%, Tm range <10°C, length CV <10%. Exclude outliers >2 SD from mean even if individually"passing" to improve pool uniformity.

Uniformity validation: Use Pool Uniformity Estimator for synthesis yield prediction
Statistical QC: Calculate and track CV, SD, interquartile range for each parameter
Outlier management: Remove sequences >2 SD from mean or modify to bring within 1.5 SD

Comprehensive Documentation for Reproducibility

Maintain QC documentation for troubleshooting, regulatory compliance (diagnostics/therapeutics), and method validation. Essential records: original sequences, QC parameters/thresholds, flagged sequences, modifications, re-QC results, final sequences, synthesis order details.

Export formats: CSV from Batch QC, synthesis formats from Format Converter
Version control: Track QC iterations (v1, v2, v3) with timestamps and modification rationale
Regulatory compliance: ISO 20395:2019 (oligonucleotide QC standard), ISO 13485 (medical devices), FDA 21 CFR Part 11 (electronic records), CLIA/CAP (clinical diagnostics)

Integrated Multi-Tool QC Pass

Comprehensive QC requires multiple specialized tools. Recommended order:

Batch Sequence QC - primary validation (all parameters)
GC Content Analyzer - distribution analysis and outlier detection
Tm Calculator - thermodynamic validation with experimental salt conditions
Secondary Structure Predictor - detailed structure analysis for flagged sequences
Pool Uniformity Estimator - synthesis yield and coverage prediction
Error Rate Calculator - synthesis quality metrics and cost estimation
Format Converter - export to vendor-specific synthesis formats

See the full page on how to QC a large oligo pool before ordering with threshold guidance and troubleshooting notes.

QC Success Metrics

Target pass rate: Define the acceptable flag rate before ordering and document any exceptions
Pool uniformity: GC SD <2%, Tm range <8°C, CV <12%
Synthesis yield: >80% sequences with >50% expected yield
NGS coverage: Median CV <20%, no sequences <10% median coverage
Experimental success: <5% PCR failure rate, <10% NGS dropout

Frequently Asked Questions

What is oligo pool QC and why is it important?▾

Oligo pool QC validates oligonucleotide sequences before synthesis to prevent platform-specific failures and ensure experimental reproducibility. Critical for array-based synthesis (Agilent, Twist Bioscience, GenScript), column synthesis (Integrated DNA Technologies/IDT, Merck/MilliporeSigma, Eurofins Genomics), and enzymatic synthesis (Molecular Assemblies, DNA Script) platforms.

Prevents synthesis failures (15-30% unchecked pools): Homopolymers >4bp cause coupling errors; GC extremes (<30%, >70%) reduce yield 50-80%
Ensures NGS library uniformity: GC bias creates 3-10x coverage variation; Tm variation (>10°C) causes differential PCR amplification
Reduces experimental failures: Secondary structures (ΔG <-3 kcal/mol) inhibit PCR (50% failure rate); self-dimers prevent primer extension
Project risk control: Pre-synthesis QC can reduce avoidable redesign, resynthesis, and validation delays
Regulatory compliance: ISO 20395:2019 defines oligonucleotide QC requirements; FDA 21 CFR Part 820, EU MDR 2017/745 mandate documented validation for diagnostic/therapeutic oligos

For pools >100 sequences, systematic QC using Batch Sequence QC is essential to identify problematic sequences before synthesis. See our full page on how to QC a large oligo pool before ordering.

What parameters should I check during QC?▾

Comprehensive QC validates 7 critical parameters with application-specific thresholds:

GC content (use GC Analyzer): 40-60% individual, 45-55% pool mean, <2% SD for NGS libraries. Extreme GC (<30%, >70%) reduces synthesis yield 50-80%
Melting temperature (use Tm Calculator): Nearest-neighbor method (SantaLucia 1998). PCR: 55-65°C, qPCR: 60-70°C. Pool uniformity: <10°C range, <3°C SD optimal
Sequence length: PCR primers 18-25bp, qPCR probes 18-30bp, CRISPR guides 19-21bp. Validate with Molecular Weight Calculator
Homopolymers: Critical: no runs >4bp (5-10x synthesis error rate). Flag poly-A/T, poly-G >3bp
Secondary structures (use Structure Predictor): Hairpin ΔG >-3 kcal/mol, self-dimer ΔG >-5 kcal/mol. Validate at 37°C (synthesis) and experimental temperature
Sequence complexity: Flag dinucleotide repeats >6bp, low entropy sequences. Each base should be 15-40% of total
Cross-reactivity (use Primer Analyzer): Check heterodimer formation in multiplex assays, avoid adapter/primer homology

Batch Sequence QC validates all parameters simultaneously with customizable thresholds. Export results for integration with synthesis order formats.

How do I set appropriate QC thresholds?▾

QC thresholds depend on application and synthesis platform. Use the ranges below as starting points and confirm vendor-specific constraints before ordering:

PCR primers (analyze with Primer Analyzer): GC 40-60%, Tm 55-65°C (±3°C pool), length 18-25bp, homopolymers <4bp, hairpin ΔG >-2 kcal/mol, 3' end GC clamp (2-3 bases)
qPCR probes/primers: GC 40-60%, Tm 60-70°C (probe 5-10°C > primers), length 18-30bp, strict secondary structure requirements (hairpin ΔG >-2 kcal/mol), no G at 5' end (quenching)
CRISPR sgRNA (use GC Analyzer): GC 40-60% (optimal 50-55%), length 19-21bp (20bp standard), avoid poly-T (>4bp = transcription terminator), check off-target similarity
NGS library adapters/indexes: GC 45-55%, Tm ±2°C (critical for multiplexing), balanced base composition (no >60% single base), edit distance >3bp between indexes
Hybridization capture probes (120mer): GC 45-55%, Tm 65-75°C (±5°C pool), avoid repetitive elements (>15bp repeats), uniqueness score >0.9
Array synthesis pools (Agilent, Twist): Uniform GC (45-55% mean, <2% SD), Tm <10°C range, homopolymers <4bp, length variation <10%, no secondary structures ΔG <-4 kcal/mol

Synthesis platform considerations:

Array synthesis (Agilent SurePrint, Twist Bioscience): Photolithography method. Strict homopolymer limits (<4bp), GC 40-60%, excellent for high-density pools (10K-1M sequences), length typically 40-200bp, cost-effective for large pools
Column synthesis (IDT, Merck/MilliporeSigma, Eurofins): Phosphoramidite chemistry. More tolerant to GC extremes (30-70%), homopolymers <6bp acceptable, higher fidelity individual oligos, length up to 300bp+, premium quality for critical applications
Enzymatic synthesis (Molecular Assemblies, DNA Script): Template-free enzymatic method (2026-2026 commercial availability). No homopolymer limitations, excellent for modified bases, length up to 200bp, slower throughput but emerging technology

Batch QC tool provides validated default thresholds with customization for specific applications. Test thresholds with pilot synthesis (96 oligos) before scaling to full pools. See Tm calculation tutorial for thermodynamic validation.

How many sequences can I QC at once?▾

Our Batch Sequence QC tool can process up to 10,000 sequences per batch. For larger pools:

Split into batches: Process 10,000 sequences at a time
Sample first: QC a representative subset to identify common issues
Pre-filter: Remove obviously problematic sequences before QC

Processing time depends on:

Number of sequences
Average sequence length
Number of QC parameters checked
Server load

Most batches of 1,000-5,000 sequences process in 30-60 seconds. Very large batches (10,000 sequences) may take 1-2 minutes.

What should I do with flagged sequences?▾

Flagged sequences require systematic remediation before synthesis. Decision tree approach:

Severity assessment: Critical flags (homopolymers >5bp, extreme GC <30% or >70%, strong secondary structures ΔG <-5 kcal/mol) require immediate action. Warning flags (GC 30-40%, Tm outliers) may be acceptable for non-critical applications
Failure mode analysis: Homopolymer flags predict 60% synthesis failure; secondary structure flags predict 50% PCR failure. Prioritize by experimental impact
Redesign strategies: Use synonymous codon substitution (protein-coding), silent mutations (non-coding), or position shift (if sequence location flexible)
Exclusion criteria: Sequences failing >2 critical parameters or requiring >5 base changes often better excluded than redesigned
Documentation (export from Batch QC): CSV with original sequence, flags, modifications, re-QC results. Required for regulatory compliance and troubleshooting

Remediation strategies by flag type:

GC content: For low GC (<40%), substitute A/T with G/C at wobble positions or silent sites. For high GC (>60%), reverse strategy. Validate with GC Analyzer
Tm uniformity: Adjust length (±2-3bp) or modify GC-rich regions. For pools, prioritize uniformity over individual Tm targets. Calculate with Tm Calculator
Homopolymers: Break poly-A/T runs with G/C substitutions at position +2 or +3 from run start. Break poly-G/C with A/T. Verify no new secondary structures created
Secondary structures (check with Structure Predictor): Disrupt hairpin stems by substituting complementary bases (e.g., G-C pair to G-T). For self-dimers, modify 3' end (last 5bp) to reduce complementarity
Low complexity: Introduce base diversity while maintaining function. For dinucleotide repeats, alternate with other bases every 4-6bp

Iterative QC review:

Initial QC with Batch Sequence QC
Categorize flags by severity (critical vs. warning)
Redesign critical failures using strategies above
Re-run QC on modified sequences
Iterate until the remaining flags are acceptable for the application and synthesis route
Export final sequences in synthesis format

For pools >1,000 sequences, expect 10-20% initial failure rate. Systematic redesign typically achieves 95-98% pass rate after 2-3 QC iterations. Sequences failing after 3 redesign attempts should be excluded or synthesized separately with verification sequencing.

How do I ensure pool uniformity?▾

Pool uniformity determines synthesis yield and experimental reproducibility. Quantitative validation metrics:

GC content uniformity (analyze with GC Analyzer): Mean 45-55%, standard deviation <2% (NGS libraries), <5% (PCR pools). Coefficient of variation (CV) <10% optimal. GC SD >5% causes 3-10x coverage bias in NGS
Melting temperature uniformity (batch Tm Calculator): Range <10°C (acceptable), <5°C (optimal), SD <3°C. Tm range >15°C causes differential amplification in PCR (up to 100-fold bias)
Length uniformity: For fixed-length pools: ±0bp (strict). For variable-length: CV <10%, no sequences >2 SD from mean. Length variation >20% affects hybridization kinetics
Compositional balance: Each base 20-30% of total pool nucleotides (deviation <5% optimal). Extreme base bias (>40% single base) causes synthesis coupling inefficiencies
Synthesis yield prediction (use Uniformity Estimator): Uniform pools (CV <15%): 80-95% representation. Non-uniform pools (CV >25%): 30-60% representation with 10-fold abundance variation

Experimental validation approaches:

NGS coverage analysis: Sequence pilot pool (10,000-100,000 reads). Ideal: median coverage CV <20%, no sequences <10% median coverage
qPCR uniformity test: Sample 20-50 sequences, measure Cq variation. Acceptable: ΔCq <2 cycles, indicating <4-fold abundance variation
Synthesis QC metrics: Array synthesis uniformity score >0.8 (vendor-provided). Column synthesis: >95% sequences with >50% expected yield

Integrated QC review for uniformity:

Batch Sequence QC - comprehensive validation
GC Content Analyzer - distribution analysis
Tm Calculator - thermodynamic uniformity
Pool Uniformity Estimator - synthesis yield prediction
Error Rate Calculator - quality metrics

Target metrics for high-quality pools: GC SD <2%, Tm range <8°C, CV <12%, >95% sequences pass QC. See complete pool QC guide with case studies and troubleshooting guidance.

Related Oligo Pool QC Pages

Run the Full Pre-Order Oligo Pool QC Guide

Use the full guide when the decision spans design, validation, remediation, and synthesis ordering.

Analyze GC Content Across Oligo Pools

Review GC distribution, outliers, and uniformity signals before moving to Tm or structure checks.

Compare Tm Across a Pool Before Ordering

Compare pool-wide Tm spread under one salt and concentration assumption before ordering.

How to Detect Secondary Structures

Identify hairpins, self-dimers, and hetero-dimers before problematic rows reach synthesis submission.

Validate PCR Primer Pools Before Submission

Validate primer-pair readiness when pool QC narrows to PCR primer sequence risk.

QC a CRISPR sgRNA Library Before Synthesis

Move here when the pool is a CRISPR guide library and coverage, guide QC, and synthesis format all matter.

Open Batch Sequence QC

Process up to 10,000 sequences with configurable QC thresholds. Review GC content, Tm spread, homopolymers, sequence complexity, and predicted structures before synthesis submission. Free, no registration required.

Run Batch Sequence QC →View the Full QC Guide