Tm Calculator Method Comparison: OligoPool.com, NEB, IDT & Thermo Fisher

OligoPool calculators use published, peer-reviewed algorithms for Tm, salt correction, secondary-structure interpretation, molecular weight, and GC content. This page documents the formulas, reference papers, and comparison conditions used to review results against NEB, IDT, and Thermo Fisher-style tools.

Matched conditions

Compare sequence, method, salt,
ions, and concentration first

Browser default

Browser by default; History/Library/API may save

Literature-based

Thermodynamic parameters are
documented in the references

1. Algorithm Transparency

OligoPool calculations use documented formulas and published parameter sources. Related tools may draw on overlapping literature, but implementation details, defaults, and buffer models can differ.

Calculator	Core Algorithm	Reference	Comparison note
Tm Calculator	Nearest-neighbor (NN) thermodynamics	SantaLucia, PNAS 1998	Related tools may use comparable NN parameter sets; confirm each tool's current method notes.
Salt Correction	Unified Na⁺/Mg²⁺ correction	Owczarzy et al., Biochemistry 2008	Published salt corrections are implemented differently across tools and buffer models.
Secondary Structure ΔG	NN stacking + loop parameters	SantaLucia 1998, Zuker 2003	Related structure tools include IDT OligoAnalyzer, UNAfold, and mfold; outputs are not assumed identical.
Molecular Weight	Sum of nucleotide MWs − (n-1) × H₂O	IUPAC atomic weights 2021	Deterministic formula for the selected bases; modifications and conventions still matter.
GC Content	(G+C) / total bases × 100	Standard definition	Standard definition for unambiguous DNA bases; input handling can differ.

Method note: Tm output depends on the algorithm, thermodynamic parameters, concentration, salt model, and implementation details. This page documents the OligoPool settings and uses selected vendor-style comparisons as examples; it does not establish vendor equivalence.

2. Method Comparison: Tm Results

We compared OligoPool output with selected NEB and IDT examples using representative primer sequences spanning different lengths, GC content, and compositions. Conditions: 50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo.

Sequence (5'→3')	Length	GC%	OligoPool	NEB	Δ
ATCGATCGATCGATCGATCG	20	50%	56.4°C	56.4°C	0.0°C
GCGCGCGCATATATATAT	18	44%	49.5°C	49.7°C	-0.2°C
GCCGCCGCCGCCGCCGCCGCC	21	100%	78.1°C	78.3°C	-0.2°C
AATTAATTAATTAATTAATT	19	0%	34.6°C	34.8°C	-0.2°C
TCAGCTGAACGGTCAGTCAG	20	55%	58.9°C	59.1°C	-0.2°C

Methodology: OligoPool values shown here use SantaLucia 1998 nearest-neighbor parameters and the salt branch selected from the listed conditions: Owczarzy 2004 for the monovalent branch or Owczarzy 2008 when the free-Mg dominance threshold selects the magnesium branch. The displayed differences are examples under the listed assumptions, not a universal tolerance or a guarantee of experimental agreement.

3. Why Small Differences Exist Between Tools

Even when two calculators use related methods, results can differ because of settings and implementation details. Compare the assumptions before interpreting a difference:

Source of Difference	Interpretation	Explanation
Rounding precision	May shift the displayed value	Different tools round intermediate ΔH/ΔS values at different points
Initiation parameters	May shift the displayed value	SantaLucia 1998 defines different initiation ΔH/ΔS for A/T vs G/C terminal pairs — implementation varies
Salt correction version	Can matter when ion conditions differ	Owczarzy 2004 vs 2008 formula; 2008 improves Mg²⁺ handling
Self-complementarity	Check self-complementarity handling	Whether the tool applies the self-complementary correction factor
Oligo concentration	Check the concentration default	Default 0.25 µM (OligoPool, NEB) vs 0.5 µM (some tools)

Interpretation: There is no single cross-tool tolerance that applies to every sequence or assay. If a result differs from another tool, first compare salt, magnesium, dNTP, additive, concentration, self-complementarity, and rounding assumptions.

4. Feature Comparison

Related method families, different feature sets. Here is where OligoPool.com differs:

Feature	OligoPool.com	NEB Tm Calculator	IDT OligoAnalyzer
Tm Algorithm	SantaLucia 1998	SantaLucia 1998	SantaLucia 1998
Salt Correction	Owczarzy 2004/2008 branch	Owczarzy 2004/2008 branch	Owczarzy 2004
Batch Tm Calculation	Up to 1,000 sequences	Single sequence	Single sequence
Secondary Structure	Hairpins and dimers	Not provided	Detailed
Pool/Library QC	Full suite	Not provided	Limited
Vendor Format Export	IDT, Twist, GenScript	Not provided	IDT only
Account Required	No	No	Free account
Data Privacy	Browser by default; History/Library/API may save	Server-side	Server-side
Price	Free	Free	Free (with account)

5. Reproduce the Comparison

Use the same sequence and reaction settings in both calculators before comparing Tm values:

Enter a test sequence

Use ATCGATCGATCGATCGATCG (20-mer, 50% GC) in our Tm Calculator.

Set standard conditions

50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo concentration.

Compare with NEB

Enter the same sequence at tmcalculator.neb.com with matching conditions, then record both outputs and the settings used.

How to read it: OligoPool displays 56.4°C for this example under the conditions shown. Another tool may return a different value even when the methods appear related; investigate the documented assumptions before treating the outputs as comparable.

6. Scientific References

Nearest-Neighbor Thermodynamics (Tm)

SantaLucia J Jr. "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proc Natl Acad Sci USA. 1998;95(4):1460-1465. doi:10.1073/pnas.95.4.1460

Salt Correction Formula

Owczarzy R, et al. "Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations." Biochemistry. 2008;47(19):5336-5353. doi:10.1021/bi702363u

Secondary Structure Prediction

Zuker M. "Mfold web server for nucleic acid folding and hybridization prediction." Nucleic Acids Res. 2003;31(13):3406-3415. doi:10.1093/nar/gkg595

Use the Referenced Calculators

Run the same sequence through the relevant calculator after checking the method assumptions and reaction settings.

Tm Calculator Structure Predictor All Tools