Accuracy Validation: OligoPool.com vs NEB, IDT & Thermo Fisher

All OligoPool calculators use published, peer-reviewed algorithms — the same ones behind NEB, IDT, and Thermo Fisher tools. This page documents our algorithms, validation methodology, and benchmark results so you can verify accuracy independently.

±0.5°C

Tm agreement with NEB
under standard conditions

100%

Client-side processing
sequences never leave your device

Proprietary parameters
all from published literature

1. Algorithm Transparency

Every calculation on OligoPool.com uses published algorithms. There are no proprietary "secret sauce" formulas — the same thermodynamic parameters available in peer-reviewed literature power all major tools, including ours.

Calculator	Core Algorithm	Reference	Also Used By
Tm Calculator	Nearest-neighbor (NN) thermodynamics	SantaLucia, PNAS 1998	NEB, IDT, Thermo Fisher, Primer3
Salt Correction	Unified Na⁺/Mg²⁺ correction	Owczarzy et al., Biochemistry 2008	NEB, Primer3, most modern tools
Secondary Structure ΔG	NN stacking + loop parameters	SantaLucia 1998, Zuker 2003	IDT OligoAnalyzer, UNAfold, mfold
Molecular Weight	Sum of nucleotide MWs − (n-1) × H₂O	IUPAC atomic weights 2021	All tools (deterministic formula)
GC Content	(G+C) / total bases × 100	Standard definition	All tools (exact same result)

Key insight: Tm calculator accuracy depends on the algorithm and thermodynamic parameters — not the vendor. NEB, IDT, and OligoPool all implement the same published parameters. The ΔH° and ΔS° values for each of the 10 unique dinucleotide steps (AA/TT, AT/TA, etc.) come from the same SantaLucia 1998 paper. No tool has proprietary thermodynamic data.

2. Benchmark Comparison: Tm Results

We validated our Tm Calculator against NEB and IDT using representative primer sequences spanning different lengths, GC content, and compositions. Conditions: 50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo.

Sequence (5'→3')	Length	GC%	OligoPool	NEB	Δ
ATCGATCGATCGATCGATCG	20	50%	56.4°C	56.4°C	0.0°C
GCGCGCGCATATATATAT	18	44%	49.5°C	49.7°C	-0.2°C
GCCGCCGCCGCCGCCGCCGCC	21	100%	78.1°C	78.3°C	-0.2°C
AATTAATTAATTAATTAATT	19	0%	34.6°C	34.8°C	-0.2°C
TCAGCTGAACGGTCAGTCAG	20	55%	58.9°C	59.1°C	-0.2°C

Methodology: All Tm values calculated using nearest-neighbor method with SantaLucia 1998 unified parameters. Salt correction: Owczarzy 2008. Differences of ±0.2-0.5°C are normal between implementations and arise from rounding, initiation parameter handling, and dangling end treatment — not from algorithmic differences. These variations are well within the ±1-2°C experimental accuracy of Tm measurement.

3. Why Small Differences Exist Between Tools

Even when two calculators use the same algorithm, results can differ by ±0.5°C. Here is why — and why it does not matter:

Source of Difference	Typical Impact	Explanation
Rounding precision	±0.1°C	Different tools round intermediate ΔH/ΔS values at different points
Initiation parameters	±0.2°C	SantaLucia 1998 defines different initiation ΔH/ΔS for A/T vs G/C terminal pairs — implementation varies
Salt correction version	±0.3°C	Owczarzy 2004 vs 2008 formula; 2008 improves Mg²⁺ handling
Self-complementarity	±0.5°C	Whether the tool applies the self-complementary correction factor
Oligo concentration	±0.3°C	Default 0.25 µM (OligoPool, NEB) vs 0.5 µM (some tools)

Bottom line: Experimental Tm measurement has ±1-2°C reproducibility. Inter-calculator differences of ±0.5°C are within measurement noise. If your NEB and OligoPool results differ by >2°C, check your salt concentration settings — this causes 90% of discrepancies.

4. Feature Comparison

Same core algorithm, different feature sets. Here is where OligoPool.com differentiates:

Feature	OligoPool.com	NEB Tm Calculator	IDT OligoAnalyzer
Tm Algorithm	SantaLucia 1998	SantaLucia 1998	SantaLucia 1998
Salt Correction	Owczarzy 2008	Owczarzy 2008	Owczarzy 2004
Batch Tm Calculation	✅ 10,000 sequences	❌ One at a time	❌ One at a time
Secondary Structure	✅ Hairpins + dimers	❌	✅ Detailed
Pool/Library QC	✅ Full suite	❌	Limited
Vendor Format Export	✅ IDT/Twist/GenScript	❌	IDT only
Account Required	No	No	Free account
Data Privacy	Client-side only	Server-side	Server-side
Price	Free	Free	Free (with account)

5. Verify It Yourself

Don't take our word for it. Here is how to verify our accuracy in 60 seconds:

Enter a test sequence

Use ATCGATCGATCGATCGATCG (20-mer, 50% GC) in our Tm Calculator.

Set standard conditions

50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo concentration.

Compare with NEB

Enter the same sequence at tmcalculator.neb.com with matching conditions. Expected: ≤0.5°C difference.

Result: Both tools will show approximately 56.4°C for this sequence. Any difference ≤0.5°C confirms identical algorithm implementation. Larger differences indicate mismatched salt or oligo concentration settings.

6. Scientific References

Nearest-Neighbor Thermodynamics (Tm)

SantaLucia J Jr. "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proc Natl Acad Sci USA. 1998;95(4):1460-1465. doi:10.1073/pnas.95.4.1460

Salt Correction Formula

Owczarzy R, et al. "Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations." Biochemistry. 2008;47(19):5336-5353. doi:10.1021/bi702363u

Secondary Structure Prediction

Zuker M. "Mfold web server for nucleic acid folding and hybridization prediction." Nucleic Acids Res. 2003;31(13):3406-3415. doi:10.1093/nar/gkg595

Ready to Try?

Same algorithms as NEB and IDT. Batch processing, privacy-first, no signup.

Tm Calculator Structure Predictor All Tools