Tm Calculator Accuracy: OligoPool.com vs NEB, IDT & Thermo Fisher

OligoPool calculators use published, peer-reviewed algorithms for Tm, salt correction, secondary-structure interpretation, molecular weight, and GC content. This page documents the formulas, reference papers, and comparison conditions used to review results against NEB, IDT, and Thermo Fisher-style tools.

±0.5°C

Typical Tm agreement with NEB
under matched conditions

Client-side

Sequences are processed
in the browser

Published

Thermodynamic parameters
come from literature

1. Algorithm Transparency

Every calculation on OligoPool.com uses published algorithms. There are no proprietary "secret sauce" formulas — the same thermodynamic parameters available in peer-reviewed literature power all major tools, including ours.

Calculator	Core Algorithm	Reference	Also Used By
Tm Calculator	Nearest-neighbor (NN) thermodynamics	SantaLucia, PNAS 1998	NEB, IDT, Thermo Fisher, Primer3
Salt Correction	Unified Na⁺/Mg²⁺ correction	Owczarzy et al., Biochemistry 2008	NEB, Primer3, most modern tools
Secondary Structure ΔG	NN stacking + loop parameters	SantaLucia 1998, Zuker 2003	IDT OligoAnalyzer, UNAfold, mfold
Molecular Weight	Sum of nucleotide MWs − (n-1) × H₂O	IUPAC atomic weights 2021	All tools (deterministic formula)
GC Content	(G+C) / total bases × 100	Standard definition	All tools (exact same result)

Method note: Tm calculator accuracy depends on the algorithm, thermodynamic parameters, and concentration settings. NEB, IDT, and OligoPool-style calculations draw from published nearest-neighbor parameters. The ΔH° and ΔS° values for each of the 10 unique dinucleotide steps (AA/TT, AT/TA, etc.) come from the SantaLucia 1998 paper.

2. Method Comparison: Tm Results

We validated our Tm Calculator against NEB and IDT using representative primer sequences spanning different lengths, GC content, and compositions. Conditions: 50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo.

Sequence (5'→3')	Length	GC%	OligoPool	NEB	Δ
ATCGATCGATCGATCGATCG	20	50%	56.4°C	56.4°C	0.0°C
GCGCGCGCATATATATAT	18	44%	49.5°C	49.7°C	-0.2°C
GCCGCCGCCGCCGCCGCCGCC	21	100%	78.1°C	78.3°C	-0.2°C
AATTAATTAATTAATTAATT	19	0%	34.6°C	34.8°C	-0.2°C
TCAGCTGAACGGTCAGTCAG	20	55%	58.9°C	59.1°C	-0.2°C

Methodology: All Tm values calculated using nearest-neighbor method with SantaLucia 1998 unified parameters. Salt correction: Owczarzy 2008. Differences of ±0.2-0.5°C are normal between implementations and arise from rounding, initiation parameter handling, and dangling end treatment — not from algorithmic differences. These variations are well within the ±1-2°C experimental accuracy of Tm measurement.

3. Why Small Differences Exist Between Tools

Even when two calculators use the same algorithm, results can differ by ±0.5°C. Here is why — and why it does not matter:

Source of Difference	Typical Impact	Explanation
Rounding precision	±0.1°C	Different tools round intermediate ΔH/ΔS values at different points
Initiation parameters	±0.2°C	SantaLucia 1998 defines different initiation ΔH/ΔS for A/T vs G/C terminal pairs — implementation varies
Salt correction version	±0.3°C	Owczarzy 2004 vs 2008 formula; 2008 improves Mg²⁺ handling
Self-complementarity	±0.5°C	Whether the tool applies the self-complementary correction factor
Oligo concentration	±0.3°C	Default 0.25 µM (OligoPool, NEB) vs 0.5 µM (some tools)

Interpretation: Experimental Tm measurement has ±1-2°C reproducibility. Inter-calculator differences of ±0.5°C are usually within measurement noise. If NEB and OligoPool results differ by more than 2°C, check salt concentration and oligo concentration settings first.

4. Feature Comparison

Same core algorithm, different feature sets. Here is where OligoPool.com differentiates:

Feature	OligoPool.com	NEB Tm Calculator	IDT OligoAnalyzer
Tm Algorithm	SantaLucia 1998	SantaLucia 1998	SantaLucia 1998
Salt Correction	Owczarzy 2008	Owczarzy 2008	Owczarzy 2004
Batch Tm Calculation	Up to 10,000 sequences	Single sequence	Single sequence
Secondary Structure	Hairpins and dimers	Not provided	Detailed
Pool/Library QC	Full suite	Not provided	Limited
Vendor Format Export	IDT, Twist, GenScript	Not provided	IDT only
Account Required	No	No	Free account
Data Privacy	Client-side only	Server-side	Server-side
Price	Free	Free	Free (with account)

5. Reproduce the Comparison

Use the same sequence and reaction settings in both calculators before comparing Tm values:

Enter a test sequence

Use ATCGATCGATCGATCGATCG (20-mer, 50% GC) in our Tm Calculator.

Set standard conditions

50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo concentration.

Compare with NEB

Enter the same sequence at tmcalculator.neb.com with matching conditions. Expected: ≤0.5°C difference.

Expected result: Both tools should return approximately 56.4°C for this sequence. A difference within 0.5°C is consistent with matched nearest-neighbor settings. Larger differences usually indicate mismatched salt, magnesium, or oligo concentration values.

6. Scientific References

Nearest-Neighbor Thermodynamics (Tm)

SantaLucia J Jr. "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proc Natl Acad Sci USA. 1998;95(4):1460-1465. doi:10.1073/pnas.95.4.1460

Salt Correction Formula

Owczarzy R, et al. "Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations." Biochemistry. 2008;47(19):5336-5353. doi:10.1021/bi702363u

Secondary Structure Prediction

Zuker M. "Mfold web server for nucleic acid folding and hybridization prediction." Nucleic Acids Res. 2003;31(13):3406-3415. doi:10.1093/nar/gkg595

Use the Referenced Calculators

Run the same sequence through the relevant calculator after checking the method assumptions and reaction settings.

Tm Calculator Structure Predictor All Tools