PCR Tm Salt Correction: Owczarzy vs SantaLucia
Trying to understand why the same primer gets a different Tm after you change Na⁺, Mg²⁺, or dNTP assumptions? This page isolates the salt-correction layer so you can see which formulas stay close to modern PCR conditions, which ones break down, and why two calculators can disagree even when they use the same nearest-neighbor thermodynamics.
Methodology
All Tm values are calculated using the SantaLucia (1998) nearest-neighbor thermodynamic parameters as the base method. The four salt correction approaches are applied independently to the same base Tm:
- Owczarzy 2008: Unified formula for mixed Na⁺/Mg²⁺ solutions with GC-dependent coefficients
- SantaLucia 1998 Salt: Log-linear Na⁺ correction (16.6 × log₁₀[Na⁺])
- von Ahsen 2001: Empirical Mg²⁺ correction developed from LightCycler data
- %GC Method: Marmur-Doty formula (81.5 + 16.6 × log₁₀[Na⁺] + 41 × GC% - 600/N)
Conditions: 250 nM oligo concentration, 0% DMSO, non-self-complementary sequences. All calculations performed client-side.
Interactive Salt Correction Comparison
Tm vs Na⁺ Concentration — 4 Methods Compared
Sequence: ATCGATCGATCGATCGATCG (20 nt)
Raw Data
| Na⁺ (mM) | Owczarzy 2008 | SL98 Salt | von Ahsen 2001 | %GC Method | Max Spread |
|---|---|---|---|---|---|
| 10 | 38.45°C | 46.59°C | 38.45°C | 38.8°C | ±8.1°C |
| 25 | 47.23°C | 50.72°C | 47.23°C | 45.4°C | ±5.3°C |
| 50 | 53.09°C | 53.93°C | 53.09°C | 50.4°C | ±3.5°C |
| 75 | 56.16°C | 55.83°C | 56.16°C | 53.3°C | ±2.9°C |
| 100 | 58.17°C | 57.19°C | 58.17°C | 55.4°C | ±2.8°C |
| 150 | 60.75°C | 59.13°C | 60.75°C | 58.3°C | ±2.5°C |
| 200 | 62.4°C | 60.52°C | 62.4°C | 60.4°C | ±2.0°C |
| 300 | 64.44°C | 62.5°C | 64.44°C | 63.3°C | ±1.9°C |
Method observation: At standard PCR conditions (50 mM Na⁺), Owczarzy 2008 and SantaLucia 1998 Salt methods usually stay close for these example sequences. The %GC method can diverge by several degrees, so it should be used only for rough estimates. The largest disagreement between NN methods occurs at extreme salt concentrations (>200 mM Na⁺ or >4 mM Mg²⁺), where Owczarzy 2008 accounts for competitive ion binding that older formulas ignore.
When to Use Each Salt Correction Method
| Method | Best For | Limitation | Used By |
|---|---|---|---|
| Owczarzy 2008 | PCR with Mg²⁺ + Na⁺/K⁺ mixed buffers | Requires both ion concentrations | NEB, OligoPool |
| SantaLucia 1998 Salt | Na⁺-only buffers (hybridization, FISH) | Does not account for Mg²⁺ effect | Primer3, early IDT |
| von Ahsen 2001 | Clinical diagnostics (standardized buffers) | Less validated for extreme GC% | Roche LightCycler |
| %GC Method | Quick mental estimates only | Ignores sequence context, ±5-10°C error | No modern tool |